Human EEF1DP3 cDNA Clone BC021729 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL734217HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF1DP3
Gene ID:
196549
Accession #:
BC021729
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human EEF1DP3 cDNA Clone BC021729 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EEF1DP3

Gene ID: 196549

Accession Number: BC021729

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTACAAACTTTCTAGTAGGTGAGAAGATCTGGTTCCACAAGTTCAAATATGGCGATGCAGAAAGGAGATTCTACGAACAGATGAACGGGCCTGTGGCCGGCGCCTCCCTCCAGGAGGCCAGCATGATCCTCCATGATATTGCCAGAGCCAGAGAGAACATCCCGAAATCCCTGGCCGGAAGCTTAGGCCCAGGGGCGTCTAGCGGCCCCAGCGGAGACCACAGCGAGCTCGTCGTCCGGATCGCCAGTCTGGAAGTGGACAACCAGAGAGACCTGGCTGAACGTGCTGGAGAAGAGCTTGCCCGGCCACTGGGCCACAGCCCCGCAGACCCAGCACATGTCTCCCATGCGCCAAGTGGAGCCCCCGGCCAAGAAGCTAGCCACACCAGCAGAGGATGA

Length: 402

View AllClose

0 Reviews

View AllClose