Human EEF1D cDNA Clone BC007847 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007431HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF1D
Gene ID:
1936
Accession #:
BC007847
Plasmid:
pUC
€605.00
Frequently bought together:

Description

Human EEF1D cDNA Clone BC007847 pUC Plasmid | Cusabio

Gene Name: EEF1D

Gene ID: 1936

Accession Number: BC007847

Vector: pUC

Sequence: ATGAGGAGCGGGAAGGCCTCCTGCACCCTGGAGACCGTGTGGGAAGACAAGCACAAGTATGAGGAGGCCGAGCGGCGCTTCTACGAACACGAGGCCACACAGGCGGCCGCCTCCGCCCAGCAGCTGCCAGCCGAGGGGCCAGCCATGAATGGGCCCGGCCAGGACGACCCTGAGGACGCTGATGAGGCGGAAGCCCCTGACGGCGGCAGCAGGCGTGATCCCAGGAAGAGCCAGGACAGCAGGAAGCCCCTGCAGAAAAAGAGGAAGCGCTCCCCCAAGAGCGGGCTCGGCCCCGCGGACCTGGCCCTCCTGGGCCTCTCGGCCGAACGTGTGTGGCTGGACAAGTCACTTTTCGACCAGGCAGAGAGCTCCTACCGCCAGAAGCTGGCAGATGTGGCTGCCCAGGCAGCCTGGCCTCCTGCCTTGGCCCCTTGGGGTCTCTGCACCCATGGAAACCAGGTGGCCTGCCACCACGTGACCTGGGGGATCTGGGTCAACAAGTCCTCCTTCGACCAGGCTGAGCGGGCCTTCGTGGAGTGGTCTCAGGCCCTGTTGCTGGCCCCCGAGGGCAGCCGCAGGCAGGGGACTCCCAACACAGGCCAGCAGGTGGCCGTCCCCGACCTGGCCCACCAGCCCAGCCCACCGGTCAATGGCCAGCCCCCGCTGGGCAGCCTGCAGGCACTGGTTCGGGAGGTGTGGCTGGAGAAGCCCCGGTATGATGCAGCCGAGAGGGGCTTCTACGAGGCCCTGTTTGACGGCCATCCCCCAGGGAAGGTGCGCCTGCAAGAGCGAGCCGGCCTGGCCGAGGGTGCCCGGCGGGGCCGCAGAGACCGGCGGGGCCGCAACATCTTAGGGAACAAGCGGGCCGGGCTGCGACGGGCCGATGGGGAGGCCCCCTCTGCCTTGCCCTACTGTTACTTCCTGCAGAAGGATGCAGAGGCCCCCTGGCTCAGCAAGCCTGCCTACGACAGCGCCGAGTGCCGCCACCACGCTGCCGAGGCCCTGCGTGTGGCCTGGTGCCTCGAAGCTGCCTCCCTGTCTCACCGACCCGGTCCTCGGTCTGGCCTGTCCGTGTCCAGCCTGAGACCCAACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGA

Length: 1944

View AllClose

0 Reviews

View AllClose