Human EDNRB cDNA Clone BC014472 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007404HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDNRB
Gene ID:
1910
Accession #:
BC014472
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human EDNRB cDNA Clone BC014472 pENTR223.1 Plasmid | Cusabio

Gene Name: EDNRB

Gene ID: 1910

Accession Number: BC014472

Vector: pENTR223.1

Sequence: ATGCAGCCGCCTCCAAGTCTGTGCGGACGCGCCCTGGTTGCGCTGGTTCTTGCCTGCGGCCTGTCGCGGATCTGGGGAGAGGAGAGAGGCTTCCCGCCTGACAGGGCCACTCCGCTTTTGCAAACCGCAGAGATAATGACGCCACCCACTAAGACCTTATGGCCCAAGGGTTCCAACGCCAGTCTGGCGCGGTCGTTGGCACCTGCGGAGGTGCCTAAAGGAGACAGGACGGCAGGATCTCCGCCACGCACCATCTCCCCTCCCCCGTGCCAAGGACCCATCGAGATCAAGGAGACTTTCAAATACATCAACACGGTTGTGTCCTGCCTTGTGTTCGTGCTGGGGATCATCGGGAACTCCACACTTCTGAGAATTATCTACAAGAACAAGTGCATGCGAAACGGTCCCAATATCTTGATCGCCAGCTTGGCTCTGGGAGACCTGCTGCACATCGTCATTGACATCCCTATCAATGTCTACAAGCTGCTGGCAGAGGACTGGCCATTTGGAGCTGAGATGTGTAAGCTGGTGCCTTTCATACAGAAAGCCTCCGTGGGAATCACTGTGCTGAGTCTATGTGCTCTGAGTATTGACAGATATCGAGCTGTTGCTTCTTGGAGTAGAATTAAAGGAATTGGGGTTCCAAAATGGACAGCAGTAGAAATTGTTTTGATTTGGGTGGTCTCTGTGGTTCTGGCTGTCCCTGAAGCCATAGGTTTTGATATAATTACGATGGACTACAAAGGAAGTTATCTGCGAATCTGCTTGCTTCATCCCGTTCAGAAGACAGCTTTCATGCAGTTTTACAAGACAGCAAAAGATTGGTGGCTGTTCAGTTTCTATTTCTGCTTGCCATTGGCCATCACTGCATTTTTTTATACACTAATGACCTGTGAAATGTTGAGAAAGAAAAGTGGCATGCAGATTGCTTTAAATGATCACCTAAAGCAGAGACGGGAAGTGGCCAAAACCGTCTTTTGCCTGGTCCTTGTCTTTGCCCTCTGCTGGCTTCCCCTTCACCTCAGCAGGATTCTGAAGCTCACTCTTTATAATCAGAATGATCCCAATAGATGTGAACTTTTGAGCTTTCTGTTGGTATTGGACTATATTGGTATCAACATGGCTTCACTGAATTCCTGCATTAACCCAATTGCTCTGTATTTGGTGAGCAAAAGATTCAAAAACTGCTTTAAGTCATGCTTATGCTGCTGGTGCCAGTCATTTGAAGAAAAACAGTCCTTGGAGGAAAAGCAGTCGTGCTTAAAGTTCAAAGCTAATGATCACGGATATGACAACTTCCGTTCCAGTAATAAATACAGCTCATCTTGA

Length: 1329

View AllClose

0 Reviews

View AllClose