Human EDN2 cDNA Clone BC034393 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007401HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDN2
Gene ID:
1907
Accession #:
BC034393
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EDN2 cDNA Clone BC034393 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EDN2

Gene ID: 1907

Accession Number: BC034393

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTCTCCGTGCCTACCACCTGGTGCTCCGTTGCGCTAGCCCTGCTCGTGGCCCTGCATGAAGGGAAGGGCCAGGCTGCTGCCACCCTGGAGCAGCCAGCGTCCTCATCTCATGCCCAAGGCACCCACCTTCGGCTTCGCCGTTGCTCCTGCAGCTCCTGGCTCGACAAGGAGTGCGTCTACTTCTGCCACTTGGACATCATCTGGGTGAACACTCCTGAACAGACAGCTCCTTACGGCCTGGGAAACCCGCCAAGACGCCGGCGCCGCTCCCTGCCAAGGCGCTGTCAGTGCTCCAGTGCCAGGGACCCCGCCTGTGCCACCTTCTGCCTTCGAAGGCCCTGGACTGAAGCCGGGGCAGTCCCAAGCCGGAAGTCCCCTGCAGACGTGTTCCAGACTGGCAAGACAGGGGCCACTACAGGAGAGCTTCTCCAAAGGCTGAGGGACATTTCCACAGTCAAGAGCCTCTTTGCCAAGCGACAACAGGAGGCCATGCGGGAGCCTCGGTCCACACATTCCAGGTGGAGGAAGAGATAG

Length: 537

View AllClose

0 Reviews

View AllClose