Human EDF1 cDNA Clone BC015500 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007398HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDF1
Gene ID:
8721
Accession #:
BC015500
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EDF1 cDNA Clone BC015500 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EDF1

Gene ID: 8721

Accession Number: BC015500

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCGAGAGCGACTGGGACACGGTGACGGTGCTGCGCAAGAAGGGCCCTACGGCCGCCCAGGCCAAATCCAAGCAGGCTATCTTAGCGGCACAGAGACGAGGAGAAGATGTGGAGACTTCCAAGAAATGGGCTGCTGGCCAGAACAAACAACATTCTATTACCAAGAACACGGCCAAGCTGGACCGGGAGACAGAGGAGCTGCACCATGACAGGGTGACCCTGGAGGTGGGCAAGGTGATCCAGCAAGGTCGGCAGAGCAAGGGGCTTACGCAGAAGGACCTGGCCACGAAAATCAATGAGAAGCCACAGGTGATCGCGGACTATGAGAGCGGACGGGCCATACCCAATAACCAGGTGCTTGGCAAAATCGAGCGGGCCATTGGCCTCAAGCTCCGGGGAAAGGACATTGGAAAGCCCATCGAGAAGGGGCCTAGGGCGAAATGA

Length: 447

View AllClose

0 Reviews

View AllClose