Human EDARADD cDNA Clone BC128082 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL855495HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDARADD
Gene ID:
128178
Accession #:
BC128082
Plasmid:
pUC
£215.20
Frequently bought together:

Description

Human EDARADD cDNA Clone BC128082 pUC Plasmid | Cusabio

Gene Name: EDARADD

Gene ID: 128178

Accession Number: BC128082

Vector: pUC

Sequence: ATGGGCCTCAGGACGACTAAACAGATAGGGAGAGGCACTAAAGCTCCTGGTCACCAAGAGGATCATATGGTAAAGGAACCAGTGGAAGACACAGACCCTAGCACTTTATCCTTTAATATGTCAGACAAATATCCCATTCAAGATACGGAACTCCCTAAAGCTGAAGAATGTGATACAATTACTTTGAACTGCCCACGAAATTCAGATATGAAAAATCAGGGAGAAGAAAATGGCTTTCCAGATAGCACTGGAGATCCTCTTCCAGAGATCAGCAAGGACAACTCCTGCAAAGAAAACTGTACTTGTTCCTCCTGCTTGCTCCGGGCCCCCACCATAAGTGACTTGCTCAATGATCAGGACTTACTAGATGTGATCAGGATAAAGCTGGATCCGTGTCACCCAACGGTGAAAAACTGGAGGAATTTTGCAAGCAAATGGGGGATGTCCTATGACGAATTGTGCTTCCTGGAGCAGAGGCCACAGAGCCCCACCTTGGAGTTCTTGCTCCGGAACAGTCAGAGGACGGTGGGCCAGCTGATGGAGCTCTGCAGGCTCTACCACAGGGCCGACGTGGAGAAGGTTCTGCGCAGGTGGGTGGACGAGGAGTGGCCCAAGCGGGAGCGTGGAGACCCCTCCAGGCACTTCTAG

Length: 648

View AllClose

0 Reviews

View AllClose