Human EDA2R cDNA Clone BC034919 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL881011HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDA2R
Gene ID:
60401
Accession #:
BC034919
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EDA2R cDNA Clone BC034919 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EDA2R

Gene ID: 60401

Accession Number: BC034919

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGATTGCCAAGAAAATGAGTACTGGGACCAATGGGGACGGTGTGTCACCTGCCAACGGTGTGGTCCTGGACAGGAGCTATCCAAGGATTGTGGTTATGGAGAGGGTGGAGATGCCTACTGCACAGCCTGCCCTCCTCGCAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGTGTTCAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGAAAGACACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAGGTTCAATGTGCCTTCCAGTTGAGCTTAGTGGAGGCAGATGCACCCACAGTGCCCCCTCAGGAGGCCACACTTGTTGCACTGGTGAGCAGCCTGCTAGTGGTGTTTACCCTGGCCTTCCTGGGGCTCTTCTTCCTCTACTGCAAGCAGTTCTTCAACAGACATTGCCAGCGTGGAGGTTTGCTGCAGTTTGAGGCTGATAAAACAGCAAAGGAGGAATCTCTCTTCCCCGTGCCACCCAGCAAGGAGACCAGTGCTGAGTCCCAAGTGAGTGAGAACATCTTTCAGACCCAGCCACTTAACCCTATCCTCGAGGACGACTGCAGCTCGACTAGTGGCTTCCCCACACAGGAGTCCTTTACCATGGCCTCCTGCACCTCAGAGAGCCACTCCCACTGGGTCCACAGCCCCATCGAATGCACAGAGCTGGACCTGCAAAAGTTTTCCAGCTCTGCCTCCTATACTGGAGCTGAGACCTTGGGGGGAAACACAGTCGAAAGCACTGGAGACAGGCTGGAGCTCAATGTGCCCTTTGAAGTTCCCAGCCCTTAA

Length: 894

View AllClose

0 Reviews

View AllClose