Human EDA cDNA Clone BC126143 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL856433HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDA
Gene ID:
1896
Accession #:
BC126143
Plasmid:
pUC
€405.00
Frequently bought together:

Description

Human EDA cDNA Clone BC126143 pUC Plasmid | Cusabio

Gene Name: EDA

Gene ID: 1896

Accession Number: BC126143

Vector: pUC

Sequence: ATGGGCTACCCGGAGGTGGAGCGCAGGGAACTCCTGCCTGCAGCAGCGCCGCGGGAGCGAGGGAGCCAGGGCTGCGGGTGTGGCGGGGCCCCTGCCCGGGCGGGCGAAGGGAACAGCTGCCTGCTCTTCCTGGGTTTCTTTGGCCTCTCGCTGGCCCTCCACCTGCTGACGTTGTGCTGCTACCTAGAGTTGCGCTCGGAGTTGCGGCGGGAACGTGGAGCCGAGTCCCGCCTTGGCGGCTCGGGCACCCCTGGCACCTCTGGCACCCTAAGCAGCCTCGGTGGCCTCGACCCTGACAGCCCCATCACCAGTCACCTTGGGCAGCCGTCACCTAAGCAGCAGCCATTGGAACCGGGAGAAGCCGCACTCCACTCTGACTCCCAGGACGGGCACCAGATGGCCCTATTGAATTTCTTCTTCCCTGATGAAAAGCCATACTCTGAAGAAGAAAGTAGGCGTGTTCGCCGCAATAAAAGAAGCAAAAGCAATGAAGGAGCAGATGGCCCAGTTAAAAACAAGAAAAAGGGAAAGAAAGCAGGACCTCCTGGACCCAATGGCCCTCCAGGACCCCCAGGACCTCCAGGACCCCAGGGACCCCCAGGAATTCCAGGGATTCCTGGAATTCCAGGAACAACTGTTATGGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACCCCCTGGCCTCCAGGGACCTTCTGGTGCTGCTGATAAAGCTGGAACTCGAGAAAACCAGCCAGCTGTGGTGCATCTACAGGGCCAAGGGTCAGCAATTCAAGTCAAGAATGATCTTTCAGGTGGAGTGCTCAATGACTGGTCTCGCATCACTATGAACCCCAAGGTGTTTAAGCTACATCCCCGCAGCGGGGAGCTGGAGGTACTGGTGGACGGCACCTACTTCATCTATAGTCAGGTAGAAGTATACTACATCAACTTCACTGACTTTGCCAGCTATGAGGTGGTGGTGGATGAGAAGCCCTTCCTGCAGTGCACACGCAGCATCGAGACGGGCAAGACCAACTACAACACTTGCTATACCGCAGGCGTCTGCCTCCTCAAGGCCCGGCAGAAGATCGCCGTCAAGATGGTGCACGCTGACATCTCCATCAACATGAGCAAGCACACCACGTTCTTTGGGGCCATCAGGCTGGGTGAAGCCCCTGCATCCTAG

Length: 1176

View AllClose

0 Reviews

View AllClose