Human ECHS1 cDNA Clone BC008906 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007382HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ECHS1
Gene ID:
1892
Accession #:
BC008906
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ECHS1 cDNA Clone BC008906 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ECHS1

Gene ID: 1892

Accession Number: BC008906

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCGCCCTGCGTGTCCTGCTGTCCTGCGTCCGCGGCCCGCTGAGGCCCCCGGTTCGCTGTCCCGCCTGGCGTCCCTTCGCCTCGGGTGCTAACTTTGAGTACATCATCGCAGAAAAAAGAGGGAAGAATAACACCGTGGGGTTGATCCAACTGAACCGCCCCAAGGCCCTCAATGCACTTTGCGATGGCCTGATTGACGAGCTCAACCAGGCCCTGAAGATCTTCGAGGAGGACCCGGCCGTGGGGGCCATTGTCCTCACCGGCGGGGATAAGGCCTTTGCAGCTGGAGCTGATATCAAGGAAATGCAGAACCTGAGTTTCCAGGACTGTTACTCCAGCAAGTTCTTGAAGCACTGGGACCACCTCACCCAGGTCAAGAAGCCAGTCATCGCTGCTGTCAATGGCTATGCCTTTGGCGGGGGCTGTGAGCTTGCCATGATGTGTGATATCATCTATGCCGGTGAGAAGGCCCAGTTTGCACAGCCGGAGATCTTAATAGGAACCATCCCAGGTGCGGGCGGCACCCAGAGACTCACCCGTGCTGTTGGGAAGTCGCTGGCGATGGAGATGGTCCTCACCGGTGACCGGATCTCAGCCCAGGACGCCAAGCAAGCAGGTCTTGTCAGCAAGATTTGTCCTGTTGAGACACTGGTGGAAGAAGCCATCCAGTGTGCAGAAAAAATTGCCAGCAATTCTAAAATTGTAGTAGCGATGGCCAAAGAATCAGTGAATGCAGCTTTTGAAATGACATTAACAGAAGGAAGTAAGTTGGAGAAGAAACTCTTTTATTCAACCTTTGCCACTGATGACCGGAAAGAAGGGATGACCGCGTTTGTGGAAAAGAGAAAGGCCAACTTCAAAGACCAGTGA

Length: 873

View AllClose

0 Reviews

View AllClose