Human ECHDC2 cDNA Clone BC044574 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL771472HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ECHDC2
Gene ID:
55268
Accession #:
BC044574
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ECHDC2 cDNA Clone BC044574 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ECHDC2

Gene ID: 55268

Accession Number: BC044574

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCTGCGCGTTCTGTGCCTCCTGCGCCCCTGGAGGCCCCTTCGGGCCCGCGGCTGCGCTTCCGACGGGGCGGCCGGGGGCTCAGAGATCCAAGTGCGCGCCCTGGCGGGTCCGGACCAAGGGATCACTGAGATTCTGATGAACAGACCTTCTGCCCGCAATGCCTTGGGGAATGTCTTCGTCAGTGAGCTGCTGGAAACTCTGGCCCAGCTGCGGGAGGACCGGCAAGTGCGTGTCCTGCTCTTCAGAAGTGGAGTGAAGGGCGTGTTCTGTGCAGGTGCAGACCTGAAGGAGCGGGAACAGATGAGTGAAGCAGAGGTGGGGGTGTTTGTCCAGCGACTCCGGGGCCTGATGGATGACATCGCAGCCTTCCCTGCACCCACCATTGCGGCTATGGATGGGTTTGCCTTGGGCGGAGGCCTAGAGCTTGCCCTGGCCTGTGACCTCCGAGTGGCAGCTTCCTCGGCAGTCATGGGACTGATTGAGACCACGCGAGGGCTCCTCCCGGGGGCAGGAGGGACTCAGAGGCTGCCCCGTTGTCTGGGGGTGGCCCTGGCGAAGGAGCTCATCTTCACGGGCCGACGACTGAGTGGAACTGAGGCCCACGTACTGGGGCTGGTGAATCACGCTGTGGCCCAGAACGAGGAGGGGGACGCCGCCTACCAGCGGGCACGAGCACTGGCCCAGGAGATCCTGCCCCAGGCCCCCATTGCGGTGCGGCTGGGCAAAGTAGCCATTGACCGAGGAACGGAGGTGGACATTGCATCTGGGATGGCCATTGAAGGGATGTGCTATGCCCAGAATATTCCAACCCGGGACCGGCTAGAGGGCATGGCAGCCTTCAGGGAGAAGCGGACTCCCAAATTTGTTGGCAAATGA

Length: 879

View AllClose

0 Reviews

View AllClose