Human ECH1 cDNA Clone BC017408 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL621643HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ECH1
Gene ID:
1891
Accession #:
BC017408
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ECH1 cDNA Clone BC017408 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ECH1

Gene ID: 1891

Accession Number: BC017408

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCGGGGATAGTGGCTTCTCGCAGACTCCGCGACCTACTGACCCGGCGACTGACAGGCTCCAACTACCCGGGACTCAGTATTAGCCTTCGCCTCACTGGCTCCTCTGCACAAGAGGCGGCTTCCGGAGTAGCCCTCGGTGAAGCCCCAGACCACAGCTATGAGTCCCTTCGTGTGACGTCTGCGCAGAAACATGTTCTGCATGTCCAGCTCAACCGGCCCAACAAGAGGAATGCCATGAACAAGGTCTTCTGGAGAGAGATGGTAGAGTGCTTCAACAAGATTTCGAGAGACGCTGACTGTCGGGCGGTGGTGATCTCTGGTGCAGGAAAAATGTTCACTGCAGGTATTGACCTGATGGACATGGCTTCGGACATCCTGCAGCCCAAAGGAGATGATGTGGCCCGGATCAGCTGGTACCTCCGTGACATCATCACTCGATACCAGGAGACCTTCAACGTCATCGAGAGGTGCCCCAAGCCCGTGATTGCTGCCGTCCATGGGGGCTGCATTGGCGGAGGTGTGGACCTTGTCACCGCCTGTGACATCCGGTACTGTGCCCAGGATGCTTTCTTCCAGGTGAAGGAGGTGGACGTGGGTTTGGCTGCCGATGTAGGAACACTGCAGCGCCTGCCCAAGGTCATCGGGAACCAGAGCCTGGTCAACGAGCTGGCCTTCACCGCCCGCAAGATGATGGCTGACGAGGCCCTGGGCAGTGGGCTGGTCAGCCGGGTGTTCCCAGACAAAGAGGTCATGCTGGATGCTGCCTTAGCGCTGGCGGCCGAGATTTCCAGCAAGAGCCCCGTGGCGGTGCAGAGCACCAAGGTCAACCTGCTGTATTCCCGCGACCATTCGGTGGCCGAGAGCCTCAACTACGTGGCGTCCTGGAACATGAGCATGCTGCAGACCCAAGACCTCGTGAAGTCGGTCCAGGCCACGACTGAGAACAAGGAACTGAAAACCGTCACCTTCTCCAAGCTCTGA

Length: 987

View AllClose

0 Reviews

View AllClose