Human EBP cDNA Clone BC001549 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL624016HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EBP
Gene ID:
10682
Accession #:
BC001549
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human EBP cDNA Clone BC001549 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EBP

Gene ID: 10682

Accession Number: BC001549

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACTACCAACGCGGGCCCCTTGCACCCATACTGGCCTCAGCACCTAAGACTGGACAACTTTGTACCTAATGACCGCCCCACCTGGCATATACTGGCTGGCCTCTTCTCTGTCACAGGGGTCTTAGTCGTGACCACATGGCTGTTGTCAGGTCGTGCTGCGGTTGTCCCATTGGGGACTTGGCGGCGACTGTCCCTGTGCTGGTTTGCAGTGTGTGGGTTCATTCACCTGGTGATCGAGGGCTGGTTCGTTCTCTACTACGAAGACCTGCTTGGAGACCAAGCCTTCTTATCTCAACTCTGGAAAGAGTATGCCAAGGGAGACAGCCGATACATCCTGGGTGACAACTTCACAGTGTGCATGGAAACCATCACAGCTTGCCTGTGGGGACCACTCAGCCTGTGGGTGGTGATCGCCTTTCTCCGCCAGCATCCCCTCCGCTTCATTCTACAGCTTGTGGTCTCTGTGGGCCAGATCTATGGGGATGTGCTCTACTTCCTGACAGAGCACCGCGACGGATTCCAGCACGGAGAGCTGGGCCACCCTCTCTACTTCTGGTTTTACTTTGTCTTCATGAATGCCCTGTGGCTGGTGCTGCCTGGAGTCCTTGTGCTTGATGCTGTGAAGCACCTCACTCATGCCCAGAGCACGCTGGATGCCAAGGCCACAAAAGCCAAGAGCAAGAAGAACTGA

Length: 693

View AllClose

0 Reviews

View AllClose