Human EBI3 cDNA Clone BC015364 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL622759HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EBI3
Gene ID:
10148
Accession #:
BC015364
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human EBI3 cDNA Clone BC015364 pENTR223.1 Plasmid | Cusabio

Gene Name: EBI3

Gene ID: 10148

Accession Number: BC015364

Vector: pENTR223.1

Sequence: ATGACCCCGCAGCTTCTCCTGGCCCTTGTCCTCTGGGCCAGCTGCCCGCCCTGCAGTGGAAGGAAAGGGCCCCCAGCAGCTCTGACACTGCCCCGGGTGCAATGCCGAGCCTCTCGGTACCCGATCGCCGTGGATTGCTCCTGGACCCTGCCGCCTGCTCCAAACTCCACCAGCCCCGTGTCCTTCATTGCCACGTACAGGCTCGGCATGGCTGCCCGGGGCCACAGCTGGCCCTGCCTGCAGCAGACGCCAACGTCCACCAGCTGCACCATCACGGATGTCCAGCTGTTCTCCATGGCTCCCTACGTGCTCAATGTCACCGCCGTCCACCCCTGGGGCTCCAGCAGCAGCTTCGTGCCTTTCATAACAGAGCACATCATCAAGCCCGACCCTCCAGAAGGCGTGCGCCTAAGCCCCCTCGCTGAGCGCCAGCTACAGGTGCAGTGGGAGCCTCCCGGGTCCTGGCCCTTCCCAGAGATCTTCTCACTGAAGTACTGGATCCGTTACAAGCGTCAGGGAGCTGCGCGCTTCCACCGGGTGGGGCCCATTGAAGCCACGTCCTTCATCCTCAGGGCTGTGCGGCCCCGAGCCAGGTACTACGTCCAAGTGGCGGCTCAGGACCTCACAGACTACGGGGAACTGAGTGACTGGAGTCTCCCCGCCACTGCCACAATGAGCCTGGGCAAGTAG

Length: 690

View AllClose

0 Reviews

View AllClose