null

Human EBF4 cDNA Clone BC054347 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL880085HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EBF4
Gene ID:
57593
Accession #:
BC054347
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human EBF4 cDNA Clone BC054347 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EBF4

Gene ID: 57593

Accession Number: BC054347

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCCCTCTAGCCCCCCGCTGGCGGCTGCCTCCTCCATGTCCCTCCCGGCCGCTGCCCCCACCACCAGCGTGTTCTCCTTCTCGCCTGTCAACATGATCTCCGCCGTCAAACAGAGGAGCGCCTTCGCCCCCGTGCTGCGCCCCCCAAGCTCCCCACCCCAGGCCTGCCCTAGAGCCCACGGAGAGGGGCTTCCAGACCAGTCTTTTGAGGATTCTGACAAGTTTCACTCTCCAGCCCGGGGGCTTCAGGGCCTGGCATACTCCTAA

Length: 267

View AllClose

0 Reviews

View AllClose