Human EBF3 cDNA Clone BC126130 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL880977HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EBF3
Gene ID:
253738
Accession #:
BC126130
Plasmid:
pUC
€530.00
Frequently bought together:

Description

Human EBF3 cDNA Clone BC126130 pUC Plasmid | Cusabio

Gene Name: EBF3

Gene ID: 253738

Accession Number: BC126130

Vector: pUC

Sequence: ATGTTTGGGATTCAGGAGAATATTCCGCGCGGGGGGACGACCATGAAGGAGGAGCCGCTGGGCAGCGGCATGAACCCGGTGCGCTCGTGGATGCACACGGCGGGCGTGGTGGACGCCAACACGGCCGCCCAGAGCGGCGTGGGGCTGGCGCGGGCGCACTTCGAGAAGCAGCCGCCTTCCAACCTCCGGAAATCCAATTTCTTCCACTTCGTGCTGGCGCTCTACGATAGGCAGGGGCAGCCGGTGGAGATTGAAAGGACCGCTTTTGTGGACTTTGTGGAGAAAGAGAAAGAGCCAAACAACGAGAAAACCAACAACGGCATCCACTATAAACTCCAGTTATTGTACAGCAACGGAGTCAGAACAGAGCAAGATCTGTATGTTCGCCTCATAGATTCAATGACCAAACAGGCCATCGTCTACGAGGGCCAGGACAAGAACCCGGAGATGTGCCGTGTGCTGCTGACCCACGAGATCATGTGCAGCCGGTGCTGTGACAAGAAAAGTTGTGGCAATAGAAACGAAACGCCCTCAGACCCTGTAATCATTGACAGATTCTTTCTAAAGTTTTTCCTCAAGTGCAATCAGAACTGTTTGAAGAATGCAGGCAACCCTCGAGATATGCGGAGATTCCAGGTTGTTGTATCGACAACAGTCAACGTGGACGGCCACGTGCTGGCCGTGTCAGACAACATGTTTGTGCACAACAATTCCAAACACGGGAGGCGGGCCCGCCGCCTAGACCCGTCAGAAGCCACTCCGTGCATCAAGGCCATCAGTCCCAGTGAAGGCTGGACCACGGGGGGTGCCACCGTCATCATAATTGGCGACAACTTCTTTGACGGGCTGCAAGTTGTATTCGGAACTATGTTGGTGTGGAGCGAGCTGATAACTCCCCATGCCATCCGAGTCCAGACCCCGCCGAGGCACATTCCTGGCGTCGTCGAAGTGACCCTCTCCTACAAATCCAAGCAGTTCTGCAAAGGTGCTCCTGGGCGCTTTGTCTACACCGCCCTTAATGAACCAACCATAGATTACGGCTTTCAGAGGTTGCAGAAAGTGATCCCAAGACATCCGGGTGATCCCGAAAGGTTACCCAAGGAGGTGTTACTGAAGCGGGCGGCGGACCTGGTGGAAGCCTTATACGGAATGCCTCACAACAACCAGGAGATCATCTTGAAGCGAGCGGCGGACATCGCCGAGGCGCTGTACAGCGTTCCCCGCAATCACAACCAGATCCCCACCCTGGGCAACAACCCTGCACACACGGGCATGATGGGCGTCAACTCCTTCAGCAGCCAGCTAGCCGTCAACGTGTCAGAGACGTCACAAGCCAACGACCAAGTCGGCTACAGTCGCAATACAAGCAGCGTGTCCCCGCGAGGCTACGTCCCCAGCAGTACTCCCCAGCAGTCCAATTACAACACAGTCAGCACTAGCATGAATGGATATGGAAGTGGCGCCATGGCCAGTCTAGGGGTCCCTGGCTCGCCTGGATTTCTTAATGGCTCCTCCGCTAACTCTCCCTACGGCATGAAACAGAAGAGCGCCTTCGCGCCCGTGGTCCGGCCCCAAGCCTCTCCTCCTCCTTCCTGCACCAGCGCCAACGGGAATGGACTGCAAGCTATGTCTGGGCTGGTAGTCCCGCCAATGTGA

Length: 1656

View AllClose

0 Reviews

View AllClose