Human EBAG9 cDNA Clone BC017729 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007355HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EBAG9
Gene ID:
9166
Accession #:
BC017729
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EBAG9 cDNA Clone BC017729 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EBAG9

Gene ID: 9166

Accession Number: BC017729

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCATCACCCAGTTTCGGTTATTTAAATTTTGTACCTGCCTAGCAACAGTATTCTCATTCCTAAAGAGATTAATATGCAGATCTGGCAGAGGACGGAAATTAAGTGGAGACCAAATAACTTTGCCAACTACAGTTGATTATTCATCAGTTCCTAAGCAGACAGATGTTGAAGAGTGGACTTCCTGGGATGAAGATGCACCCACCAGTGTAAAGATCGAAGGAGGGAATGGGAATGTGGCAACACAACAAAATTCTTTGGAACAACTGGAACCTGACTATTTTAAGGACATGACACCAACTATTAGGAAAACTCAGAAAATTGTTATTAAGAAGAGAGAACCATTGAATTTTGGCATCCCAGATGGGAGCACAGGTTTCTCTAGTAGATTAGCAGCTACACAAGATCTGCCTTTTATTCATCAGTCTTCTGAATTAGGTGACTTAGATACCTGGCAGGAAAATACCAATGCATGGGAAGAAGAAGAAGATGCAGCCTGGCAAGCAGAAGAAGTTCTGAGACAGCAGAAACTAGCAGACAGAGAAAAGAGAGCAGCCGAACAACAAAGGAAGAAAATGGAAAAGGAAGCACAACGGCTAATGAAGAAGGAACAAAACAAAATTGGTGTGAAACTTTCATAA

Length: 642

View AllClose

0 Reviews

View AllClose