Human EARS2 cDNA Clone BC040013 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL705509HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EARS2
Gene ID:
124454
Accession #:
BC040013
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human EARS2 cDNA Clone BC040013 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EARS2

Gene ID: 124454

Accession Number: BC040013

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCGCTCCTGAGGAGACTGCTGCAGCGCGAGAGGCCTTCGGCGGCCTCTGGCCGCCCCGTAGGACGGCGCGAGGCCAACCTGGGCACTGATGCCGGGGTTGCGGTGCGAGTGCGGTTCGCTCCCAGCCCCACAGGCTTCTTGCACCTGGGTGGCCTCCGCACTGCCTTGTACAACTACATCTTTGCTAAGAAGTACCAGGGGAGCTTCATCCTGAGGCTAGAGGACACAGATCAGACTCGCGTTGTGCCTGGGGCAGCAGAGAATATTGAGGACATGCTGGAGTGGGCAGGCATCCCGCCTGATGAGAGCCCCCGCCGGGGCGGTCCTGCTGGGCCCTACCAGCAATCTCAGCGGTTGGAGCTGTATGCCCAGGCCACAGAAGCGCTGCTGAAGACCGGAGCTGCTTACCCCTGTTTCTGCTCACCCCAGCGGCTGGAGCTCCTGAAGAAGGAGGCCTTGCGGAACCACCAGACGCCCCGGTATGACAATCGGTGCAGGAACATGAGCCAGGAGCAGGTGGCCCAGAAGCTGGCCAAGGACCCCAAGCCTGCGATCCGCTTCCGCCTGGAGCAGGTGGTGCCAGCCTTCCAGGACCTGGTGTATGGCTGGAATAGGCATGAAGTGGCCAGCGTGGAGGGAGACCCAGTCATCATGAAGAGCGACGGCTTCCCCACATACCACCTGGCCTGCGTGGTGGACGACCACCACATGGGCATCAGCCACGTGCTGCGAGGCTCTGAGTGGCTCGTCTCCACTGCCAAGCACCTGCTCCTCTACCAGGCCCTGGGCTGGCAGCCACCCCACTTCGCCCACCTGCCCCTGCTCCTCAACAGGGATGGCAGCAAGCTCTCCAAGAGGCAAGGGGACGTTTTCCTGGAGCACTTTGCTGCTGATGGCTTCCTGCCCGATTCCTTGTTGGACATCATCACCAACTGTGGCTCAGGTTTTGCAGAGAACCAAATGGGCAGGACCCTGCCGGAGCTGATCACACAGTTCAACCTGACACAGGTCACCTGTCACTCAGCCCTGCTGGACCTGGAGAAGCTCCCAGAATTCAACAGACTGCACCTCCAGCGGCTGGTGAGCAATGAGAGCCAGAGGCGCCAGCTGGTGGGGAAGCTGCAGGTCCTTGTGGAGGAGGCCTTTGGTTGCCAGCTGCAAAACAGGGATGTCCTCAACCCAGTCTACGTGGAGAGGATCCTCCTGCTGAGACAGGGTCACATTTGCCGCCTGCAGGACTTGGTGTCCCCAGTATACTCTTACCTGTGGACTCGCCCTGCAGTAGGTCGAGCACAGCTGGACGCCATCTCGGAGAAGGTGGATGTGATTGCCAAGCGTGTGCTGGGGCTTCTAGAAAGATCTGGTATGAGCTTAACTCAGGATATGCTGAATGGAGAACTGAAGAAGCTATCAGAAGGTTTGGAAGGCACCAAGTACAGTAATGTGATGAAACTCCTTCGGATGGCCCTCAGTGGACAGCAGGTGAGGCAGGGACACGGGTTGGATTGTTCCCTGGAGCCCCTCATTGATCCTTTGAACTTACATTTCCTGGCAGGCACTGAGCTCAATATTGAGTATACAAAGGTGAATGAAACATGA

Length: 1605

View AllClose

0 Reviews

View AllClose