Human EAPP cDNA Clone BC001245 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007353HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EAPP
Gene ID:
55837
Accession #:
BC001245
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EAPP cDNA Clone BC001245 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EAPP

Gene ID: 55837

Accession Number: BC001245

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACCGGCTTCCGGATGACTACGACCCCTACGCGGTTGAAGAGCCTAGCGACGAGGAGCCGGCTTTGAGCAGCTCTGAGGATGAAGTGGATGTGCTTTTACATGGAACTCCTGACCAAAAACGAAAACTCATCAGAGAATGTCTTACCGGAGAAAGTGAATCATCTAGTGAAGATGAATTTGAAAAGGAGATGGAAGCTGAATTAAATTCTACCATGAAAACAATGGAGGACAAGTTATCCTCTCTGGGAACTGGATCTTCCTCAGGAAATGGAAAAGTTGCAACAGCTCCGACAAGGTACTACGATGATATATATTTTGATTCTGATTCCGAGGATGAAGACAGAGCAGTACAGGTGACCAAGAAAAAAAAGAAGAAACAACACAAGATTCCAACAAATGACGAATTACTGTATGATCCTGAAAAAGATAACAGAGATCAGGCCTGGGTTGATGCACAGAGAAGGGGTTACCATGGTTTGGGACCACAGAGATCACGTGAACAACAGCCTGTTCCAAATAGTGATGCTGTCTTGAATTGTCCTGCCTGCATGACCACACTTTGCCTTGATTGCCAAAGGCATGAATCATACAAAACTCAATATAGAGCAATGTTTGTAATGAATTGTTCTATTAACAAAGAGGAGGTTCTAAGATATAAAGCCTCAGAGAACAGGAAGAAAAGGCGGGTCCATAAGAAGATGAGGTCTAACCAGGAAGATGCTGCTGAGAAGGCAGAGACAGATGTGGAAGAAATCTATCACCCAGTCATGTGCACTGAATGTTCCACTGAAGTGGCAGTCTACGACAAGGATGAAGTCTTTCATTTTTTCAATGTTTTAGCAAGCCATTCCTAA

Length: 858

View AllClose

0 Reviews

View AllClose