Human EAF2 cDNA Clone BC014209 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL856910HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EAF2
Gene ID:
55840
Accession #:
BC014209
Plasmid:
pUC
€304.00
Frequently bought together:

Description

Human EAF2 cDNA Clone BC014209 pUC Plasmid | Cusabio

Gene Name: EAF2

Gene ID: 55840

Accession Number: BC014209

Vector: pUC

Sequence: ATGAATAGCGCAGCGGGATTCTCACACCTAGACCGTCGCGAGCGGGTTCTCAAGTTAGGGGAGAGTTTCGAGAAGCAGCCGCGCTGCGCCTTCCACACTGTGCGCTATGACTTCAAACCTGCTTCTATTGACACTTCTTCTGAAGGATACCTTGAGGTTGGTGAAGGTGAACAGGTGACCATAACTCTGCCAAATATAGAAGGTTCAACTCCACCAGTAACTGTTTTCAAAGGTTCAAAAAAACCTTACTTAAAAGAATGCATTTTGATTATTAACCATGATACTGGAGAATGTCGGCTAGAAAAACTCAGCAGCAACATCACTGTAAAAAAAACAAGAGTTGAAGGAAGCAGTAAAATTCAGTATCGTAAAGAACAACAGCAACAACAAATGTGGAATTCAGCCAGGACTCCCAATCTTGTAAAACATTCTCCATCTGAAGATAAGATGTCCCCAGCATCTCCAATAGATGATATCGAAAGAGAACTGAAGGCAGAAGCTAGTCTAATGGACCAGATGAGTAGTTGTGATAGTTCATCAGATTCCAAAAGTTCATCATCTTCAAGTAGTGAGGATAGTTCTAGTGACTCAGAAGATGAAGATTGCAAATCCTCTACTTCTGATACAGGGAATTGTGTCTCAGGACATCCTACCATGACACAGTACAGGATTCCTGATATAGATGCCAGTCATAATAGATTTCGAGACAACAGTGGCCTTCTGATGAATACTTTAAGAAATGATTTGCAGCTGAGTGAATCAGGAAGTGACAGTGATGACTGA

Length: 783

View AllClose

0 Reviews

View AllClose