Human EAF1 cDNA Clone BC041329 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822235HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EAF1
Gene ID:
85403
Accession #:
BC041329
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EAF1 cDNA Clone BC041329 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EAF1

Gene ID: 85403

Accession Number: BC041329

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATGGGACCGCAAACCCGCTGCTGGACCGCGAGGAACATTGCCTGAGGCTCGGGGAGAGCTTCGAGAAGCGGCCGCGGGCCTCCTTCCACACTATTCGTTATGATTTTAAACCAGCATCTATAGACACTTCCTGTGAAGGAGAGCTTCAAGTTGGCAAAGGAGATGAAGTCACAATTACACTTCCACATATCCCTGGATCCACACCACCCATGACTGTGTTCAAGGGGAACAAACGGCCTTACCAGAAAGACTGTGTGCTTATTATTAATCATGACACTGGTGAATTTGTGCTGGAAAAACTCAGTAGCAGCATTCAGGTGAAGAAAACAAGAGCTGAGGGCAGCAGTAAAATCCAGGCCCGAATGGAACAGCAGCCCACTCGTCCTCCACAGACGTCACAGCCACCACCACCTCCACCACCTATGCCATTCAGAGCTCCAACGAAGCCTCCAGTTGGACCCAAAACTTCTCCCTTGAAAGATAACCCCTCACCTGAACCTCAGTTGGATGACATCAAAAGAGAGCTGAGGGCTGAAGTTGACATTATTGAACAAATGAGCAGCAGCAGTGGGAGCAGCTCTTCAGACTCTGAGAGCTCTTCGGGAAGTGATGACGATAGCTCCAGCAGTGGAGGCGAGGACAATGGCCCAGCCTCTCCTCCGCAGCCTTCACACCAGCAGCCCTACAACAGTAGGCCTGCCGTTGCCAATGGAACCAGCCGGCCACAAGGAAGCAACCAGCTCATGAACGCCCTCAGAAATGACTTGCAGTTGAGTGAGTCTGGCAGTGACAGTGATGACTAG

Length: 807

View AllClose

0 Reviews

View AllClose