Human E4F1 cDNA Clone BC080524 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL721093HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
E4F1
Gene ID:
1877
Accession #:
BC080524
Plasmid:
pUC
$854.40
Frequently bought together:

Description

Human E4F1 cDNA Clone BC080524 pUC Plasmid | Cusabio

Gene Name: E4F1

Gene ID: 1877

Accession Number: BC080524

Vector: pUC

Sequence: ATGGAGGGCGCGATGGCAGTGCGGGTGACGGCCGCTCATACGGCAGAAGCCCAGGCCGAAGCCGGGCGGGAAGCGGGCGAGGGTGCAGTTGCGGCGGTGGCGGCGGCCTTGGCCCCCAGCGGCTTCCTCGGCCTCCCGGCGCCCTTCAGCGAGGAAGATGAGGACGATGTGCACAGATGCGGCCGCTGCCAGGCAGAGTTCACCGCCTTGGAGGATTTTGTTCAGCACAAGATTCAGAAGGCCTGCCAGCGGGCCCCTCCGGAGGCCCTGCCTGCCACCCCTGCCACCACAGCGTTGCTGGGCCAGGAGGTGGTGCCGGCAGCACCAGGCCCAGAGGAGCCCATCACTGTGGCCCACATCGTGGTGGAGGCGGCCTCTCTGGCAGCAGACATCAGCCACGCATCTGACCTTGTTGGTGGTGGGCACATCAAAGAGGTCATCGTGGCTGCTGAGGCGGAGCTGGGAGACGGTGAGATGGCCGAGGCCCCGGGCAGCCCCCACCAGCAGGGGCTGGGGCTCGCAGGGGAGGGTGAGCAGGCCCAGGTGAAGCTACTGGTGAACAAGGATGGCCGCTATGTGTGTGCGCTGTGCCACAAGACCTTCAAGACGGGCAGCATCCTCAAGGCCCACATGGTCACTCACAGCAGCCGCAAGGACCACGAGTGCAAGCTCTGTGGGGCCTCCTTCCGCACCAAGGGCTCACTCATCCGGCACCACCGGCGGCACACGGATGAGCGCCCCTACAAGTGCTCCAAGTGTGGAAAGAGCTTCCGGGAGTCGGGTGCACTGACCCGGCACCTCAAGTCTCTCACCCCCTGCACAGAGAAAATCCGCTTCAGTGTGAGCAAGGACGTGGTTGTCAGCAAAGAGGACGCACGTGCAGGTTCTGGAGCTGGAGCTGCCGGCTTGGGGACAGCCACATCATCGGTGACAGGCGAGCCTATAGAGACTTCACCCGTGATTCACCTGGTGACAGATGCCAAGGGCACCGTCATCCACGAAGTCCACGTCCAGATGCAGGAGCTGTCCCTGGGCATGAAAGCCCTGGCCCCAGAGCCCCCCGTCTCCCAGGAGCTCCCCTGCTCCAGCGAGGGCAGCCGTGAGAACCTGCTGCACCAGGCCATGCAGAACTCCGGCATCGTCCTTGAGCGCGCTGCTGGGGAGGAGGGTGCCCTGGAGCCAGCTCCTGCTGCCGGGTCCAGTCCCCAGCCCCTGGCAGTGGCAGCCCCGCAGCTGCCGGTACTGGAAGTGCAGCCGCTGGAGACACAGGTGGCCAGCGAGGCCTCAGCGGTGCCCAGGACCCACCCATGTCCTCAGTGCAGTGAGACCTTCCCGACAGCAGCCACCCTGGAGGCCCACAAGAGGGGCCACACCGGGCCGAGGCCGTTCGCCTGCGCGCAGTGTGGCAAGGCCTTCCCCAAGGCCTACCTGCTCAAGAAGCACCAGGAGGTGCACGTGCGTGAGCGCCGCTTCCGCTGTGGCGACTGCGGGAAGCTCTACAAGACCATTGCCCATGTGCGTGGCCACCGGCGCGTCCACTCAGACGAGCGGCCCTACCCTTGTCCCAAGTGTGGCAAGCGCTACAAGACTAAGAACGCACAGCAGGTGCACTTCAGGACACACCTGGAGGAGAAGCCGCACGTGTGCCAGTTCTGCAGCCGTGGCTTCCGAGAGAAGGGCTCACTGGTGCGGCACGTGCGACACCACACAGGCGAGAAGCCGTTCAAGTGCTACAAGTGCGGCCGTGGCTTCGCCGAGCACGGCACGCTGAACCGGCACCTGCGCACCAAAGGGGGCTGCCTGCTGGAGGTGGAGGAGTTGCTGGTGTCTGAGGACAGCCCCGCGGCAGCCACCACCGTCCTCACGGAAGACCCGCACACAGTGTTGGTGGAGTTCTCGTCCGTGGTAGCTGACACCCAGGAGTATATCATCGAGGCCACTGCGGACGATGCGGAGACCAGTGAGGCCACGGAGATCATCGAGGGCACCCAGACAGAGGTGGACAGCCACATCATGAAGGTGGTGCAGCAGATCGTGCACCAGGCTAGCGCCGGCCACCAGATCATCGTGCAGAACGTCACCATGGACGAGGAGACGGCGCTGGGCCCAGAGGCGGCTGCCGCCGACACCATCACCATCGCCACCCCCGAGAGCCTGACAGAGCAGGTGGCCATGACGCTGGCCTCGGCCATCAGCGAGGGCACTGTGCTTGCCGCCCGGGCAGGGACAAGTGGCACTGAACAGGCCACTGTGACCATGGTGTCATCAGAGGACATCGAGATCCTGGAGCATGCAGGCGAGCTGGTCATCGCCTCGCCGGAGGGCCAGCTGGAGGTGCAGACGGTCATCGTCTAG

Length: 2355

View AllClose

0 Reviews

View AllClose