Human E2F6 cDNA Clone BC008348 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007347HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
E2F6
Gene ID:
1876
Accession #:
BC008348
Plasmid:
pUC
€319.00
Frequently bought together:

Description

Human E2F6 cDNA Clone BC008348 pUC Plasmid | Cusabio

Gene Name: E2F6

Gene ID: 1876

Accession Number: BC008348

Vector: pUC

Sequence: ATGAGTCAGCAGCGGCCGGCGAGGAAGTTACCCAGTCTCCTCCTGGACCCGACGGAGGAGACGGTTCGCCGTCGGTGCCGAGACCCCATCAACGTGGAGGGCCTGCTGCCATCAAAAATAAGGATTAATTTAGAAGATAATGTACAATATGTGTCCATGAGAAAAGCTCTAAAAGTGAAGAGACCTCGTTTTGATGTATCGCTGGTTTATTTAACTCGAAAATTTATGGATCTTGTCAGATCTGCTCCCGGGGGTATTCTTGACTTAAACAAGGTTGCAACGAAACTGGGAGTCCGAAAGCGGAGAGTGTATGACATCACCAATGTCTTAGATGGAATCGACCTCGTTGAAAAGAAATCCAAGAACCATATTAGATGGATAGGATCTGATCTTAGCAATTTTGGAGCAGTTCCCCAACAAAAGAAGCTACAGGAGGAACTTTCTGACTTATCAGCAATGGAAGATGCTTTGGATGAGTTAATTAAGGATTGTGCTCAGCAGCTGTTTGAGTTAACAGATGACAAAGAAAATGAAAGACTAGCATATGTGACCTATCAAGACATTCATAGCATTCAGGCCTTCCATGAACAGATCGTCATTGCAGTTAAAGCTCCAGCAGAAACCAGATTGGATGTTCCAGCTCCCAGAGAAGACTCTATCACAGTGCACATAAGGAGCACCAACGGACCTATCGATGTCTATTTGTGTGAAGTGGAGCAGGGTCAGACCAGTAACAAAAGGTCTGAAGGTGTCGGGACCTCTTCATCTGAGAGCACTCATCCAGAAGGCCCTGAGGAAGAAGAAAATCCTCAGCAAAGTGAAGAATTGCTTGAAGTAAGCAACTGA

Length: 846

View AllClose

0 Reviews

View AllClose