Human E2F3 cDNA Clone BC016847 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007342HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
E2F3
Gene ID:
1871
Accession #:
BC016847
Plasmid:
pENTR223.1
$256.80
Frequently bought together:

Description

Human E2F3 cDNA Clone BC016847 pENTR223.1 Plasmid | Cusabio

Gene Name: E2F3

Gene ID: 1871

Accession Number: BC016847

Vector: pENTR223.1

Sequence: ATGCAAAGTGGTGGTGGGGTCAAGACAGATGACACCAGCACTTTAAACTCTTTGTGTGGGTATGCGTGGGTGTATGTTTGGGAAGAAAAACAAAGGTGCAGACTATCTTCCTTTTTTTCTTCTTCAGCCTCCATCCCTGGCCTCCTCCCCTCACACACACTGGACTTGGTACAAAATGTCGGTGTGGTCCTAGATGAAGCATTGGGGTGGGGGAGGGAGAGGGAGCTTTGTGTTAAGTGCCTACTGGAAATGCACTGTGGGGTTTTTTCCTGTATGGGAAACCATTTATGCCAAGCTTTTCCCCATTTCCCATATTTATCTCATCTGGTTAGCTGCCTCTGCTTCCAGCTTTGTGTAATTCTCTTTGCCAGCTGCACAAAGCTGATTTTTTCCAAAGTCTAA

Length: 402

View AllClose

0 Reviews

View AllClose