Human E2F2 cDNA Clone BC007609 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL623909HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
E2F2
Gene ID:
1870
Accession #:
BC007609
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human E2F2 cDNA Clone BC007609 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: E2F2

Gene ID: 1870

Accession Number: BC007609

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGTCTCGCTCTGTTGCCCAGGCTGGAGTGCAGTGGCCTGATCTCGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGCGATTCTTCTGCCTCAGCCTCCAGAGTAGCTGGGACTATAGACATGCACCACCACGCCCGGCTAATTTTGTATTTTTGGTCGAGACGGGGTTTTGCCATGTTAGTCAGGCTGGTCTTGAACTCCTGACCTCAAGTGATCCACCACCTCGGCCTCCCAAAGTGTTGAGATGA

Length: 252

View AllClose

0 Reviews

View AllClose