null

Human DCTN3 cDNA Clone BC000319 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL006566HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DCTN3
Gene ID:
11258
Accession #:
BC000319
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human DCTN3 cDNA Clone BC000319 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: DCTN3

Gene ID: 11258

Accession Number: BC000319

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGGGTGTACGGGCCGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTGCAGGTGGCTTTGGGGAACATTTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAGATTGAAGATCTGATCAAGTACCTGGATCCTGAGTACATCGACCGCATTGCCATACCTGATGCCTCTAAGCTGCAATTCATCCTAGCAGAGGAGCAGTTTATCCTTTCCCAGGTTGCACTCCTGGAGCAGGTGAATGCCTTGGTGCCCATGCTGGACAGTGCTCACATCAAAGCCGTTCCTGAGCATGCTGCCCGCCTGCAGCGCTTGGCCCAGATCCACATTCAGCAGCAGGCTCCATGGGGAGTGGGAGTCCGTGATGAGGCAGGAAGTTTAGTGGAAGATGTGGGCTTTGCCCAGTTCCTTTCTGTGCTACACTTTGGCCCTACAGGACCAGTGTGTGGAAATCACTGA

Length: 531

View AllClose

0 Reviews

View AllClose