null

Human DCTD cDNA Clone BC001286 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL006563HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DCTD
Gene ID:
1635
Accession #:
BC001286
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human DCTD cDNA Clone BC001286 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: DCTD

Gene ID: 1635

Accession Number: BC001286

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTGAAGTTTCCTGCAAGAAACGGGACGACTATTTGGAATGGCCAGAGTATTTTATGGCTGTGGCCTTCTTATCAGCACAGAGAAGCAAAGATCCAAATTCCCAGGTCGGCGCCTGCATCGTGAATTCAGAAAACAAGATTGTCGGGATTGGGTACAATGGGATGCCAAATGGGTGCAGTGATGACGTGTTGCCTTGGAGAAGGACAGCAGAGAATAAGCTGGACACCAAATACCCGTACGTGTGCCATGCGGAGCTGAATGCCATCATGAACAAAAATTTGACCGATGTGAAAGGCTGTAGTATGTATGTCGCCTTGTTCCCTTGTAATGAATGCGCTAAGCTCATCATCCAGGCAGGTATAAAAGAAGTGATTTTCATGTCTGATAAATACCATGATAGTGACGAGGCAACTGCTGCGAGGCTCCTGTTTAATATGGCCGGGGTGACATTCCGGAAATTCATACCGAAGTGCAGCAAGATTGTCATTGACTTTGATTCAATTAACAGCAGACCGAGTCAAAAGCTTCAGTGA

Length: 537

View AllClose

0 Reviews

View AllClose