null

Human DCLRE1C cDNA Clone BC009185 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL857026HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DCLRE1C
Gene ID:
64421
Accession #:
BC009185
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$416.40
Frequently bought together:

Description

Human DCLRE1C cDNA Clone BC009185 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: DCLRE1C

Gene ID: 64421

Accession Number: BC009185

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAGCATCAGGAGAGGTTTTTATTTCAGGGCAATAATGGAACTGTCCTGTACACAGGAGACTTCAGATTGGCGCAAGGAGAAGCTGCTAGAATGGAGCTTCTGCACTCCGGGGGCAGAGTCAAAGACATCCAAAGTGTATATTTGGATACTACGTTCTGTGATCCAAGATTTTACCAAATTCCAAGTCGGGAGGAGTGTTTAAGTGGAGTCTTAGAGCTGGTCCGAAGCTGGATCACTCGGAGCCCGTACCATGTTGTGTGGCTGAACTGCAAAGCGGCTTATGGCTATGAATATCTGTTCACCAACCTTAGTGAAGAATTAGGAGTCCAGGTTCATGTGAATAAGCTAGACATGTTTAGGAACATGCCTGAGATCCTTCATCATCTCACAACAGACCGCAACACTCAGATCCATGCATGCCGGCATCCCAAGGCAGAGGAATATTTTCAGTGGAGCAAATTACCCTGTGGAATTACTTCCAGAAATAGAATTCCACTCCACATAATCAGCATTAAGCCATCCACCATGTGGTTTGGAGAAAGGAGCAGAAAAACAAATGTAATTGTGAGGACTGGAGAGAGTTCATACAGAGCTTGTTTTTCTTTTCACTCCTCCTACAGTGAGATTAAAGATTTCTTGAGCTACCTCTGTCCTGTGAACGCATATCCAAATGTCATTCCAGTTGGCACAACTATGGATAAAGTTGTCGAAATCTTAAAGCCTTTATGCCGGTCTTCCCAAAGTACGGAGCCAAAGTATAAACCACTGGGAAAACTGAAGAGAGCTAGAACAGTTCACCGAGACTCAGAGGAGGAAGATGACTATCTCTTTGATGATCCTCTGCCAATACCTTTAAGGCACAAAGTTCCATACCCGGAAACTTTTCACCCTGAGGTATTTTCAATGACTGCAGTATCAGAAAAGCAGCCTGAAAAACTGAGACAAACCCCAGGATGCTGCAGAGCAGAGTGTATGCAGAGCTCTCGTTTCACAAACTTTGTAGATTGTGAAGAATCCAACAGTGAAAGTGAAGAAGAAGTAGGAATCCCAGCTTCACTGCAAGGAGATCTGGGCTCTGTACTTCACCTGCAAAAGGCTGATGGGGATGTACCCCAGTGGGAAGTATTCTTTAAAAGAAATGATGAAATCACAGATGAGAGTTTGGAAAACTTCCCTTCCTCCACAGTGGCAGGGGGATCTCAGTCACCAAAGCTTTTCAGTGACTCTGATGGAGAATCAACTCACATCTCCTCCCAGAATTCTTCCCAGTCAACACACATAACAGAACAAGGAAGTCAAGGCTGGGACAGCCAATCTGATACTGTTTTGTTATCTTCCCAAGAGAGAAACAGTGGGGATATTACTTCCTTGGACAAAGCTGACTACAGACCAACAATCAAAGAGAATATTCCTGCCTCTCTCATGGAACAAAATGTAATTTGCCCAAAGGATACTTACTCTGATTTGAAAAGCAGAGATAAAGATGTGACAATAGTTCCTAGTACTGGAGAACCAACTACTCTAAGCAGTGAGACACATATACCCGAGGAAAAAAGTTTGCTAAATCTTAGCACAAATGCAGATTCCCAGAGCTCTTCTGATTTTGAAGTTCCCTCAACTCCAGAAGCTGAGTTACCTAAACGAGAGCATTTACAATATTTATATGAGAAGCTGGCAACTGGTGAGAGTATAGCAGTCAAAAAAAGAAAATGCTCACTCTTAGATACCTAA

Length: 1734

View AllClose

0 Reviews

View AllClose