null

Human DAZ1 cDNA Clone BC114927 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL868293HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DAZ1
Gene ID:
1617
Accession #:
BC114927
Plasmid:
pUC
€578.00
Frequently bought together:

Description

Human DAZ1 cDNA Clone BC114927 pUC Plasmid | Cusabio

Gene Name: DAZ1

Gene ID: 1617

Accession Number: BC114927

Vector: pUC

Sequence: ATGTCTGCTGCAAATCCTGAGACTCCAAACTCAACCATCTCCAGAGAGGCCAGCACCCAGTCTTCATCAGCTGCAGCTAGCCAAGGCTGGGTGTTACCAGAAGGCAAAATCGTGCCAAACACTGTTTTTGTTGGTGGAATTGATGCTAGGATGGATGAAACTGAGATTGGAAGCTGCTTTGGTAGATACGGTTCAGTGAAAGAAGTGAAGATAATCACGAATCGAACTGGTGTGTCCAAAGGCTATGGATTTGTTTCGTTTGTTAATGACGTGGATGTCCAGAAGATAGTAGGATCACAGATACATTTCCATGGTAAAAAGCTGAAGCTGGGCCCTGCAATCAGGAAACAAAAGTTATGTGCTCGTCATGTGCAGCCACGTCCTTTGGTAGTTAATCCTCCTCCTCCACCACAGTTTCAGAACGTCTGGCGGAATCCAAACACTGAAACCTACCTGCAGCCCCAAATCACGCCGAATCCTGTAACTCAGCACGTTCAGTCTGCTGCAAATCCTGAGACTCCAAACTCAACCATCTCCAGAGAGGCCAGCACCCAGTCTTCATCAGCTGCAGCTAGCCAAGGCTGGGTGTTACCAGAAGGCAAAATCGTGCCAAACACTGTTTTTGTTGGTGGAATTGATGCTAGGATGGATGAAACTGAGATTGGAAGCTGCTTTGGTAGATACGGTTCAGTGAAAGAAGTGAAGATAATCACGAATCGAACTGGTGTGTCCAAAGGCTATGGATTTGTTTCGTTTGTTAATGACGTGGATGTCCAGAAGATAGTAGGATCACAGATACATTTCCATGGTAAAAAGCTGAAGCTGGGCCCTGCAATCAGGAAACAAAAGTTATGTGCTCGTCATGTGCAGCCACGTCCTTTGGTAGTTAATCCTCCTCCTCCACCACAGTTTCAGAACGTCTGGCGGAATCCAAACACTGAAACCTACCTGCAGCCCCAAATCACGCCGAATCCTGTAACTCAGCACGTTCAGTCTGCTGCAAATCCTGAGACTCCAAACTCAACCATCTCCAGAGAGGCCAGCACCCAGTCTTCATCAGCTGCAGCTAGCCAAGGCTGGGTGTTACCAGAAGGCAAAATCGTGCCAAACACTGTTTTTGTTGGTGGAATTGATGCTAGGATGGATGAAACTGAGATTGGAAGCTGCTTTGGTAGATACGGTTCAGTGAAAGAAGTGAAGATAATCACGAATCGAACTGGTGTGTCCAAAGGCTATGGATTTGTTTCGTTTGTTAATGACGTGGATGTCCAGAAGATAGTAGGATCACAGATACATTTCCATGGTAAAAAGCTGAAGCTGGGCCCTGCAATCAGGAAACAAAAGTTATGTGCTCGTCATGTGCAGCCACGTCCTTTGGTAGTTAATCCTCCTCCTCCACCACAGTTTCAGAACGTCTGGCGGAATCCAAACACTGAAACCTACCTGCAGCCCCAAATCACGCCGAATCCTGTAACTCAGCACGTTCAGGCTTACTCTGCTTATCCACATTCACCAGGTCAGGTCATCACTGGATGTCAGTTGCTTGTATATAATTATCAGGAATATCCTACTTATCCCGATTCAGCATTTCAGGTCACCACTGGATATCAGTTGCCTGTATATAATTATCAGCCATTTCCTGCTTATCCAAGATCACCATTTCAGGTCACTGCTGGATATCAGTTGCCTGTATATAATTATCAGGCATTTCCTGCTTATCCAAATTCACCATTTCAAGTCGCCACTGGATATCAGTTCCCTGTATGTGAAATTTGCAAAATACTGGTATTAAAGAACGCTGCAGCTTTTTTATGTCACTCAAAGGTTAATCGGAGTATCTGA

Length: 1842

View AllClose

0 Reviews

View AllClose