null

Human DARS2 cDNA Clone BC045173 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL747490HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DARS2
Gene ID:
55157
Accession #:
BC045173
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human DARS2 cDNA Clone BC045173 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: DARS2

Gene ID: 55157

Accession Number: BC045173

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTACTTCCCTTCTTGGTTAAGTCAGCTGTACAGGGGTTTATCCAGACCCATCAGAAGGACCACCCAACCGATCTGGGGTTCTCTCTACAGAAGTCTGTTGCAGAGTTCACAGAGGAGAATTCCAGAATTCAGTAGCTTTGTTGTCCGGACCAACACATGTGGAGAGTTGCGTTCGTCTCACTTAGGCCAAGAAGTCACCTTGTGTGGATGGATTCAGTACCGAAGGCAAAACACATTCTTGGTCCTAAGAGATTTCGATGGGCTTGTTCAAGTTATCATTCCCCAGGATGAGTCGGCAGCCTCTGTGAAGAAGATTTTATGTGAAGCCCCTGTGGAATCTGTGGTGCAAGTGTCTGGTACAGTCATTTCCCGTCCTGCAGGACAAGAGAATCCAAAAATGCCAACAGGTGAGATTGAAATCAAAGTTAAAACAGCTGAGCTTCTGAATGCCTGCAAGAAGCTGCCCTTTGAAATTAAGAACTTCGTGAAGAAAACAGAGGCTCTTCGGTTGCAGTATCGCTACTTAGACTTGCGTAGTTTCCAAATGCAGTATAACCTGCGACTGAGGTCCCAGATGGTCATGAAAATGCGGGAATATCTCTGTAATCTGCATGGGTTTGTGGATATAGAAACCCCCACATTGTTTAAGAGGACCCCAGGGGGTGCCAAAGAGTTTTTAGTACCATCCAGGGAACCTGGAAAGTTTTATTCTCTCCCTCAGAGTCCTCAACAGTTTAAGCAACTTCTGATGGTTGGCGGTTTAGACAGATATTTTCAGGTTGCCCGATGTTATCGAGATGAAGGTTCAAGACCAGACAGACAGCCTGAGTTTACTCAGATTGACATAGAGATGTCATTTGTAGACCAGACTGGGATCCAGAGTTTAATTGAGGGTTTGCTCCAGTATTCCTGGCCCAATGACAAAGATCCTGTGGTTGTTCCTTTTCCTACTATGACTTTTGCTGAGGTGCTGGCCACCTATGGAACTGATAAACCTGACACTCGCTTTGGAATGAAGATTATAGATATCAGTGATGTGTTTAGAAACACAGAGATTGGATTTCTTCAAGATGCACTTAGTAAGCCCCATGGAACTGTGAAAGCCATATGTATCCCTGAAGGAGCAAAATACTTAAAAAGGAAAGACATTGAATCCATTAGAAACTTTGCAGCTGACCATTTTAATCAGGAAATCTTACCTGTATTCCTTAACGCCAATAGAAACTGGAATTCTCCAGTTGCTAATTTCATAATGGAGTCACAAAGACTGGAATTAATCAGACTAATGGAGACCCAAGAGGAAGATGTGGTCCTACTAACTGCTGGAGAGCACAATAAAGCATGCTCTTTGTTAGGAAAATTACGACTGGAATGTGCTGACCTTCTAGAAACAAGAGGAGTGGTGCTCCGTGACCCCACTCTGTTCTCTTTCCTTTGGGTGGTAGATTTCCCACTCTTCCTGCCCAAGGAGGAAAATCCCAGAGAGCTGGAATCGGCCCACCACCCATTTACTGCTCCCCACCCCAGTGACATACATCTCCTGTACACTGAGCCCAAAAAGGCCCGTAGCCAACACTATGACTTGGTTTTAAATGGCAATGAAATAGGAGGTGGTTCAATTCGAATTCACAATGCAGAGCTGCAGCGTTATATCCTGGCAACCTTACTAAAGGAGGATGTGAAAATGCTCTCCCATCTGCTCCAGGCTTTAGATTATGGGGCACCCCCTCATGGAGGAATTGCCTTAGGGTTAGACAGACTGATATGCCTTGTCACTGGATCTCCAAGCATCAGAGATGTCATAGCCTTCCCAAAGTCCTTCCGGGGACATGACCTCATGAGCAATACCCCAGATTCTGTCCCTCCTGAGGAACTGAAGCCCTATCATATCCGAGTCTCCAAGCCAACAGACTCCAAAGCAGAAAGAGCTCATTGA

Length: 1938

View AllClose

0 Reviews

View AllClose