null

Human DAP cDNA Clone BC002726 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL006496HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DAP
Gene ID:
1611
Accession #:
BC002726
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human DAP cDNA Clone BC002726 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: DAP

Gene ID: 1611

Accession Number: BC002726

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTTCGCCTCCCGAAGGGAAACTAGAGACTAAAGCTGGACACCCGCCCGCCGTGAAAGCTGGTGGAATGCGAATTGTGCAGAAACACCCACATACAGGAGACACCAAAGAAGAGAAAGACAAGGATGACCAGGAATGGGAAAGCCCCAGTCCACCTAAACCCACTGTGTTCATCTCTGGGGTCATCGCCCGGGGTGACAAAGATTTCCCCCCGGCGGCTGCGCAGGTGGCTCACCAGAAGCCGCATGCCTCCATGGACAAGCATCCTTCCCCAAGAACCCAGCACATCCAGCAGCCACGCAAGTGA

Length: 309

View AllClose

0 Reviews

View AllClose