null

Human DAG1 cDNA Clone BC012740 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL613486HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DAG1
Gene ID:
1605
Accession #:
BC012740
Plasmid:
pUC
€799.00
Frequently bought together:

Description

Human DAG1 cDNA Clone BC012740 pUC Plasmid | Cusabio

Gene Name: DAG1

Gene ID: 1605

Accession Number: BC012740

Vector: pUC

Sequence: ATGAGGATGTCTGTGGGCCTCTCGCTGCTGCTGCCCCTCTGGGGGAGGACCTTTCTCCTCCTGCTCTCTGTGGTTATGGCTCAGTCCCACTGGCCCAGTGAACCCTCAGAGGCTGTCAGGGACTGGGAAAACCAGCTTGAGGCATCCATGCACTCAGTGCTCTCAGACCTCCACGAGGCTGTTCCCACAGTGGTTGGCATTCCTGATGGCACGGCTGTCGTCGGGCGCTCATTTCGAGTGACCATTCCAACAGATTTGATTGCCTCCAGTGGAGATATCATCAAGGTATCAGCGGCAGGGAAGGAGGCTTTGCCATCTTGGCTGCACTGGGACTCACAGAGCCACACCCTGGAGGGCCTCCCCCTTGACACTGATAAGGGTGTGCATTACATTTCAGTGAGCGCTACACGGCTGGGGGCCAACGGGAGCCACATCCCCCAGACCTCCAGTGTGTTCTCCATCGAGGTCTACCCTGAAGACCACAGTGAGCTGCAGTCGGTGAGGACAGCCTCCCCAGACCCTGGTGAGGTGGTATCATCTGCCTGTGCTGCGGATGAACCTGTGACTGTTTTGACGGTGATTTTGGATGCCGACCTCACCAAGATGACCCCAAAGCAAAGGATTGACCTCCTGCACAGGATGCGGAGCTTCTCAGAAGTAGAGCTTCACAACATGAAATTAGTGCCGGTGGTGAATAACAGACTATTTGACATGTCGGCCTTCATGGCTGGCCCGGGAAATGCAAAAAAGGTGGTGGAGAATGGGGCCCTTCTCTCCTGGAAGCTGGGCTGCTCCCTGAACCAGAACAGTGTGCCTGACATTCATGGTGTAGAGGCCCCTGCCAGGGAGGGCGCAATGTCTGCTCAGCTTGGCTACCCTGTGGTGGGTTGGCACATCGCCAATAAGAAGCCCCCTCTTCCCAAACGCGTCCGGAGGCAGATCCATGCTACACCCACACCTGTCACTGCCATTGGGCCCCCAACCACGGCTATCCAGGAGCCCCCATCCAGGATCGTGCCAACCCCCACATCTCCAGCCATTGCTCCTCCAACAGAGACCATGGCTCCTCCAGTCAGGGATCCTGTTCCTGGGAAACCCACGGTCACCATCCGGACTCGAGGCGCCATTATTCAAACCCCAACCCTAGGCCCCATCCAGCCTACTCGGGTGTCAGAAGCTGGCACCACAGTTCCTGGCCAGATTCGCCCAACGATGACCATTCCTGGCTATGTGGAGCCTACTGCAGTTGCTACCCCTCCCACAACCACCACCAAGAAGCCACGAGTATCCACACCAAAACCAGCAACGCCTTCAACTGACTCCACCACCACCACGACTCGCAGGCCAACCAAGAAACCACGGACACCCCGGCCAGTGCCCCGGGTCACCACCAAAGTTTCCATCACCAGATTGGAAACTGCCTCACCGCCTACTCGTATTCGCACCACCACCAGTGGAGTGCCCCGTGGCGGAGAACCCAACCAGCGCCCAGAGCTCAAGAACCATATTGACAGGGTAGATGCCTGGGTTGGCACCTACTTTGAGGTGAAGATCCCGTCAGACACTTTCTATGACCATGAGGACACCACCACTGACAAGCTGAAGCTGACCCTGAAACTGCGGGAGCAGCAGCTGGTGGGCGAGAAGTCCTGGGTACAGTTCAACAGCAACAGCCAGCTCATGTATGGCCTTCCCGACAGCAGCCACGTGGGCAAACACGAGTATTTCATGCATGCCACAGACAAGGGGGGCCTGTCGGCTGTGGATGCCTTCGAGATCCACGTCCACAGGCGCCCCCAAGGGGATAGGGCTCCTGCAAGGTTCAAGGCCAAGTTTGTGGGTGACCCGGCACTGGTGTTGAATGACATCCACAAGAAGATTGCCTTGGTAAAGAAACTGGCCTTCGCCTTTGGAGACCGAAACTGTAGCACCATCACCCTGCAGAATATCACCCGGGGCTCCATCGTGGTGGAATGGACCAACAACACACTGCCCTTGGAGCCCTGCCCCAAGGAGCAGATCGCTGGGCTGAGCCGCCGGATCGCTGAGGATGATGGAAAACCTCGGCCTGCCTTCTCCAACGCCCTAGAGCCTGACTTTAAGGCCACAAGCATCACTGTGACGGGCTCTGGCAGTTGTCGGCACCTACAGTTTATCCCTGTGGTACCACCCAGGAGAGTGCCCTCAGAGGCGCCGCCCACAGAAGTGCCTGACAGGGACCCTGAGAAGAGCAGTGAGGATGATGTCTACCTGCATACAGTCATTCCGGCCGTGGTGGTCGCAGCCATCCTGCTCATTGCTGGCATCATTGCCATGATCTGCTACCGCAAGAAGCGGAAGGGCAAGCTTACCCTTGAGGACCAGGCCACCTTCATCAAGAAGGGGGTGCCTATCATCTTTGCAGACGAACTGGACGACTCCAAGCCCCCACCCTCCTCCAGCATGCCACTCATTCTGCAGGAGGAGAAGGCTCCCCTACCCCCTCCTGAGTACCCCAACCAGAGTGTGCCCGAGACCACTCCTCTGAACCAGGACACCATGGGAGAGTACACGCCCCTGCGGGATGAGGATCCCAATGCGCCTCCCTACCAGCCCCCACCGCCCTTCACAGCACCCATGGAGGGCAAGGGCTCCCGTCCCAAGAACATGACCCCATACCGGTCACCTCCTCCCTATGTCCCACCTTAA

Length: 2688

View AllClose

0 Reviews

View AllClose