null

Human DAB1 cDNA Clone BC067447 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL006479HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DAB1
Gene ID:
1600
Accession #:
BC067447
Plasmid:
pUC
€466.00
Frequently bought together:

Description

Human DAB1 cDNA Clone BC067447 pUC Plasmid | Cusabio

Gene Name: DAB1

Gene ID: 1600

Accession Number: BC067447

Vector: pUC

Sequence: ATGTCAACTGAGACAGAACTTCAAGTAGCTGTGAAAACCAGCGCCAAGAAAGACTCCAGAAAGAAAGGTCAGGATCGCAGTGAAGCCACTTTGATAAAGAGGTTTAAAGGTGAAGGGGTCCGGTACAAAGCCAAATTGATCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACATGTTATGTCAAGATTCCATGATGAAACTCAAGGGCGTTGTTGCTGGCGCTCGTTCCAAAGGAGAACACAAACAGAAAATCTTTTTAACCATCTCCTTTGGAGGAATCAAAATCTTTGATGAGAAGACAGGGGTTCCCACCAGCCAAAAGAAGGAAGGTGTTTATGATGTGCCAAAAAGTCAACCTGTAAGTAATGGCTATTCGTTTGAGGATTTTGAAGAACGGTTTGCTGCAGCCACCCCGAACAGAAACCTGCCCACAGACTTTGATGAGATTTTTGAGGCAACGAAGGCTGTGACCCAATTAGAACTTTTTGGGGACATGTCCACACCCCCTGATATAACCTCTCCTTCCACTCCTGCAACTCCAGGTGATGCCTTTATCCCATCTTCATCTCAGACCCTTCCAGCGAGTGCAGATGTGTTTAGTTCTGTACCTTTCGGCACTGCTGCTGTACCCTCAGGTTACGTTGCAATGGGCGCTGTCCTCCCGTCCTTCTGGGGTCAGCAGCCCCTCGTCCAACAGCAGATGGTCATGGGTGCCCAGCCACCAGTCGCTCAGGTGATGCCGGGGGCTCAGCCCATCGCATGGGGCCAGCCGGGTCTCTTTCCTGCCACTCAGCAGCCCTGGCCAACTGTGGCCGGGCAGTTTCCGCCAGCCGCCTTCATGCCCACACAAACTGTTATGCCTTTGCCAGCTGCCATGTTCCAAGGTCCCCTCACCCCCCTTGCCACCGTCCCAGGCACGAGTGACTCCACCAGGTCAAGTCCACAGACCGACAAGCCCAGGCAGAAAATGGGCAAAGAAACGTTTAAGGATTTCCAGATGGCCCAGCCTCCGCCCGTGCCCTCCCGCAAACCCGACCAGCCCTCCCTCACCTGTACCTCAGAGGCCTTCTCCAGTTACTTCAACAAAGTCGGGGTGGCACAGGATACAGACGACTGTGATGACTTTGACATCTCCCAGTTGAATTTGACCCCTGTGACTTCTACCACACCATCGACCAACTCACCTCCAACCCCAGCCCCTAGACAGAGCTCTCCATCCAAATCATCTGCATCCCATGCCAGTGATCCTACCACAGATGACATCTTTGAAGAGGGCTTTGAAAGTCCCAGCAAAAGCGAAGAGCAAGAAGCTCCTGATGGATCACAGGCCTCATCCAACAGTGATCCATTTGGTGAGCCCAGTGGGGAGCCCAGTGGTGATAATATAAGTCCACAGGCCGGTAGCTAG

Length: 1410

View AllClose

0 Reviews

View AllClose