Cusabio Customized Plasmid
Human C21orf119 cDNA Clone BC007928 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL846635HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- C21orf119
- Gene ID:
- 84996
- Accession #:
- BC007928
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human C21orf119 cDNA Clone BC007928 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: C21orf119
Gene ID: 84996
Accession Number: BC007928
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGGGCGAGCGGACACTCCACGACACCCCCCGCCCCCGGCTGCAGGGTTTGGGGTCCACCGGGGCGCATTTCTGATCCCAGTGGCTCTTCGGGTGCTCTTGGCCGGAAGAACTCCCAGACCTTTCACTCCTGGCCTGGCCGATCCACGAAGACTCGGGCCCCGGCGCGTCCAAGCAGCACAATGA
Length: 186
Related Products
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€347.00
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid | CusabioGene Name: FZD2Gene ID: 2535Accession Number: BC113402Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL622766HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FZD2
- Gene ID:
- 2535
- Accession #:
- BC113402
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid | CusabioGene Name: G6PCGene ID: 2538Accession Number: BC130478Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009118HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC
- Gene ID:
- 2538
- Accession #:
- BC130478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid | CusabioGene Name: FUNDC2Gene ID: 65991Accession Number: BC000255Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL861153HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FUNDC2
- Gene ID:
- 65991
- Accession #:
- BC000255
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human G6PC2 cDNA Clone BC113376 pENTR223.1 or pUC Plasmid | CusabioGene Name: G6PC2Gene ID: 57818Accession Number: BC113376Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL873624HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC2
- Gene ID:
- 57818
- Accession #:
- BC113376
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FYCO1 cDNA Clone BC007218 pENTR223.1 or pUC Plasmid | CusabioGene Name: FYCO1Gene ID: 79443Accession Number: BC007218Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL866262HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FYCO1
- Gene ID:
- 79443
- Accession #:
- BC007218
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human GABPB2 cDNA Clone BC027033 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human GABPB2 cDNA Clone BC027033 pENTR223.1 or pUC Plasmid | CusabioGene Name: GABPB2Gene ID: 126626Accession Number: BC027033Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL844704HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GABPB2
- Gene ID:
- 126626
- Accession #:
- BC027033
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human GCET2 cDNA Clone BC030506 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human GCET2 cDNA Clone BC030506 pENTR223.1 or pUC Plasmid | CusabioGene Name: GCET2Gene ID: 257144Accession Number: BC030506Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL854052HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GCET2
- Gene ID:
- 257144
- Accession #:
- BC030506
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human GEMIN8 cDNA Clone BC003607 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human GEMIN8 cDNA Clone BC003607 pENTR223.1 or pUC Plasmid | CusabioGene Name: GEMIN8Gene ID: 54960Accession Number: BC003607Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL873675HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GEMIN8
- Gene ID:
- 54960
- Accession #:
- BC003607
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human GAGE5 cDNA Clone BC024914 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human GAGE5 cDNA Clone BC024914 pENTR223.1 or pUC Plasmid | CusabioGene Name: GAGE5Gene ID: 2577Accession Number: BC024914Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009186HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- GAGE5
- Gene ID:
- 2577
- Accession #:
- BC024914
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC