Cusabio Customized Plasmid
Human C17orf101 cDNA Clone BC009297 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL757661HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- C17orf101
- Gene ID:
- 79701
- Accession #:
- BC009297
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human C17orf101 cDNA Clone BC009297 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: C17orf101
Gene ID: 79701
Accession Number: BC009297
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGCCACCTCTCTCTCTTCTCCTCTCCCAGGTCGCGTCTCCTTCTTCACCTCGGGGTCCGAGAACCTACACCGCGTGGAGAAGGTCCACTGGGGCACCCGTTACGCCATTACCATCGCCTTCAGCTGCAACCCCGACCATGGCATCGAGGACCCAGCGTTCCCGTAG
Length: 168
Related Products
Human C17orf101 cDNA Clone BC023602 pUC Plasmid
Cusabio pUC Plasmid
€358.00
Human C17orf101 cDNA Clone BC023602 pUC Plasmid | CusabioGene Name: C17orf101Gene ID: 79701Accession Number: BC023602Vector: pUCSequence:...
- SKU:
- CSB-CL757661HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- C17orf101
- Gene ID:
- 79701
- Accession #:
- BC023602
- Plasmid:
- pUC
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid | CusabioGene Name: DNAL1Gene ID: 83544Accession Number: BC005343Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL683815HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- DNAL1
- Gene ID:
- 83544
- Accession #:
- BC005343
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM133AGene ID: 286499Accession Number: BC113385Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL822736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM133A
- Gene ID:
- 286499
- Accession #:
- BC113385
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM46CGene ID: 54855Accession Number: BC131726Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL736203HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM46C
- Gene ID:
- 54855
- Accession #:
- BC131726
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FASLG cDNA Clone BC017502 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FASLG cDNA Clone BC017502 pENTR223.1 or pUC Plasmid | CusabioGene Name: FASLGGene ID: 356Accession Number: BC017502Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL008434HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FASLG
- Gene ID:
- 356
- Accession #:
- BC017502
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC