null

Human C10orf114 cDNA Clone BC130594 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL722567HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
C10orf114
Gene ID:
399726
Accession #:
BC130594
Plasmid:
pUC
€206.00
Frequently bought together:

Description

Human C10orf114 cDNA Clone BC130594 pUC Plasmid | Cusabio

Gene Name: C10orf114

Gene ID: 399726

Accession Number: BC130594

Vector: pUC

Sequence: ATGCAATCGCGGGAGCCCTCAGGGTGGCGCACGGCGGAGAGGCGACGCGGGTGGCGCTGCAGAGGCGTCCCCACCCCCTCCGGGGACCGGGGCCCCGGAGCTGCCAGGCCCGCTGCACGCGGCGGCGCGGGAGAAACCACGGGGCAGCAGCGCCCCCTGCAGGTGCCGGGCGCCTCCGCAGCCGCTGCGCGGACCCGACTCTTAAGGTGGCACCACCGGGTTCCCAGCCCGCGCGCAACCCGCAGCCCTGGCTCCATCCGCCGCACTTCTCCCTGTAGCGGCGGGCCTGACCGTCCGGAACGGCCGGAGTGTGCTGATGCCTGCTGCTATCTGCTTGATCCCTTCACCCTACCTCTCATCCAGGACTTCTTCCGCGGATGCGCAGCTAGCGATTTCGACAGGCGAGATTGA

Length: 411

View AllClose

0 Reviews

View AllClose