null

Human BUD31 cDNA Clone BC022821 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL002886HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BUD31
Gene ID:
8896
Accession #:
BC022821
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human BUD31 cDNA Clone BC022821 pENTR223.1 Plasmid | Cusabio

Gene Name: BUD31

Gene ID: 8896

Accession Number: BC022821

Vector: pENTR223.1

Sequence: ATGCCTAAAGTCAAAAGAAGCCGGAAAGCACCCCCAGATGGCTGGGAGTTGATTGAGCCAACACTGGATGAATTAGATCAAAAGATGAGAGAAGCTGAAACAGAACCGCATGAGGGAAAGAGGAAAGTGGAATCTCTGTGGCCCATCTTCAGGATCCACCACCAGAAAACCCGCTACATCTTCGACCTCTTTTACAAGCGGAAAGCCATCAGCAGAGAACTCTATGAATATTGTATTAAAGAAGGCTATGCAGACAAAAACCTGATTGCAAAATGGAAAAAGCAAGGATATGAGAACTTGTGCTGCCTGCGGTGCATTCAGACACGGGACACCAACTTCGGGACGAACTGCATCTGCCGCGTGCCCAAAAGCAAGCTGGAAGTGGGCCGCATCATCGAGTGCACACACTGTGGCTGTCGTGGCTGCTCTGGCTGA

Length: 435

View AllClose

0 Reviews

View AllClose