Human BTG2 cDNA Clone BC105949 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL002864HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BTG2
Gene ID:
7832
Accession #:
BC105949
Plasmid:
pUC
€223.00
Frequently bought together:

Description

Human BTG2 cDNA Clone BC105949 pUC Plasmid | Cusabio

Gene Name: BTG2

Gene ID: 7832

Accession Number: BC105949

Vector: pUC

Sequence: ATGAGCCACGGGAAGGGAACCGACATGCTCCCGGAGATCGCCGCCGCCGTGGGCTTCCTCTCCAGCCTCCTGAGGACCCGGGGCTGCGTGAGCGAGCAGAGGCTTAAGGTCTTCAGCGGGGCGCTCCAGGAGGCACTCACAGAGCACTACAAACACCACTGGTTTCCCGAAAAGCCGTCCAAGGGCTCCGGCTACCGCTGCATTCGCATCAACCACAAGATGGACCCCATCATCAGCAGGGTGGCCAGCCAGATCGGACTCAGCCAGCCCCAGCTGCACCAGCTGCTGCCCAGCGAGCTGACCCTGTGGGTGGACCCCTATGAGGTGTCCTACCGCATTGGGGAGGACGGCTCCATCTGCGTCTTGTACGAGGAGGCCCCACTGGCCGCCTCCTGTGGGCTCCTCACCTGCAAGAACCAAGTGCTGCTGGGCCGGAGCAGCCCCTCCAAGAACTACGTGATGGCAGTCTCCAGCTAG

Length: 477

View AllClose

0 Reviews

View AllClose