Human BRSK1 cDNA Clone BC016681 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL837438HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BRSK1
Gene ID:
84446
Accession #:
BC016681
Plasmid:
pUC
€469.00
Frequently bought together:

Description

Human BRSK1 cDNA Clone BC016681 pUC Plasmid | Cusabio

Gene Name: BRSK1

Gene ID: 84446

Accession Number: BC016681

Vector: pUC

Sequence: ATGCGGAGCCTGCCATCCAACGGAGAGCTGGACCCCGACGTCCTAGAGAGCATGGCATCACTGGGCTGCTTCAGGGACCGCGAGAGGCTGCATCGCGAGCTGCGCAGTGAGGAGGAGAACCAAGAAAAGATGATATATTATCTGCTTTTGGATCGGAAGGAGCGGTATCCCAGCTGTGAGGACCAGGACCTGCCTCCCCGGAATGATGTTGACCCCCCCCGGAAGCGTGTGGATTCTCCCATGCTGAGTCGTCACGGGAAGCGGCGACCAGAGCGGAAGTCCATGGAAGTCCTGAGCATCACCGATGCCGGGGGTGGTGGCTCCCCTGTACCCACACGACGGGCCTTGGAGATGGCCCAGCACAGCCAGAGATCCCGTAGCGTCAGTGGAGCCTCCACGGGTCTGTCCTCCAGCCCTCTAAGCAGCCCAAGGAGTCCGGTCTTTTCCTTTTCACCGGAGCCGGGGGCTGGAGATGAGGCTCGAGGCGGGGGCTCCCCGACTTCCAAAACGCAGACGCTGCCTTCTCGGGGCCCCAGGGGTGGGGGCGCCGGGGAGCAGCCCCCGCCCCCCAGTGCCCGCTCCACACCCCTGCCCGGCCCCCCAGGCTCCCCGCGCTCCTCTGGCGGGACCCCCTTGCACTCGCCTCTGCACACGCCCCGGGCCAGTCCCACCGGGACCCCGGGGACAACACCACCCCCCAGCCCCGGCGGTGGCGTCGGGGGAGCCGCCTGGAGGAGTCGTCTCAACTCCATCCGCAACAGCTTCCTGGGCTCCCCTCGCTTTCACCGGCGCAAGATGCAGGTCCCTACCGCTGAGGAGATGTCCAGCTTGACGCCAGAGTCCTCCCCGGAGCTGGCAAAACGCTCCTGGTTCGGGAACTTCATCTCCTTGGACAAAGAAGAACAAATATTCCTCGTGCTAAAGGACAAACCTCTCAGCAGCATCAAAGCAGACATCGTCCATGCCTTTCTGTCGATCCCCAGCCTGAGTCACAGTGTGCTGTCACAGACCAGCTTCAGGGCCGAGTACAAAGCCAGTGGCGGCCCCTCCGTCTTCCAAAAGCCCGTCCGCTTCCAGGTGGACATCAGCTCCTCTGAGGGTCCAGAGCCCTCCCCGCGACGGGACGGCAGCGGAGGTGGTGGCATCTACTCCGTCACCTTCACTCTCATCTCGGGTCCCAGCCGTCGGTTCAAGCGAGTGGTGGAGACCATCCAGGCACAGCTCCTGAGCACTCATGACCAGCCCTCCGTGCAGGCCCTGGCAGACGAGAAGAACGGGGCCCAGACCCGGCCTGCTGGTGCCCCACCCCGAAGCCTGCAGCCCCCACCCGGCCGCCCAGACCCAGAGCTGAGCAGCTCTCCCCGCCGAGCCCCCCCCAAGGACAAGAAGCTCCTGGCCACCAACGGGACCCCTCTGCCCTGA

Length: 1422

View AllClose

0 Reviews

View AllClose