Human BMX cDNA Clone BC016652 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL002761HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BMX
Gene ID:
660
Accession #:
BC016652
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human BMX cDNA Clone BC016652 pENTR223.1 Plasmid | Cusabio

Gene Name: BMX

Gene ID: 660

Accession Number: BC016652

Vector: pENTR223.1

Sequence: ATGGATACAAAATCTATTCTAGAAGAACTTCTTCTCAAAAGATCACAGCAAAAGAAGAAAATGTCACCAAATAATTACAAAGAACGGCTTTTTGTTTTGACCAAAACAAACCTTTCCTACTATGAATATGACAAAATGAAAAGGGGCAGCAGAAAAGGATCCATTGAAATTAAGAAAATCAGATGTGTGGAGAAAGTAAATCTCGAGGAGCAGACGCCTGTAGAGAGACAGTACCCATTTCAGATTGTCTATAAAGATGGGCTTCTCTATGTCTATGCATCAAATGAAGAGAGCCGAAGTCAGTGGTTGAAAGCATTACAAAAAGAGATAAGGGGTAACCCCCACCTGCTGGTCAAGTACCATAGTGGGTTCTTCGTGGACGGGAAGTTCCTGTGTTGCCAGCAGAGCTGTAAAGCAGCCCCAGGATGTACCCTCTGGGAAGCATATGCTAATCTGCATACTGCAGTCAATGAAGAGAAACACAGAGTTCCCACCTTCCCAGACAGAGTGCTGAAGATACCTCGGGCAGTTCCTGTTCTCAAAATGGATGCACCATCTTCAAGTACCACTCTAGCCCAATATGACAACGAATCAAAGAAAAACTATGGCTCCCAGCCACCATCTTCAAGTACCAGTCTAGCGCAATATGACAGCAACTCAAAGAAAATCTATGGCTCCCAGCCAAACTTCAACATGCAGTATATTCCAAGGGAAGACTTCCCTGACTGGTGGCAAGTAAGAAAACTGAAAAGTAGCAGCAGCAGTGAAGATGTTGCAAGCAGTAACCAAAAAGAAAGAAATGTGAATCACACCACCTCAAAGATTTCATGGGAATTCCCTGAGTCAAGTTCATCTGAAGAAGAGGAAAACCTGGATGATTATGACTGGTTTGCTGGTAACATCTCCAGATCACAATCTGAACAGTTACTCAGACAAAAGGGAAAAGAAGGAGCATTTATGGTTAGAAATTCGAGCCAAGTGGGAATGTACACAGTGTCCTTATTTAGTAAGGCTGTGAATGATAAAAAAGGAACTGTCAAACATTACCACGTGCATACAAATGCTGAGAACAAATTATACCTGGCAGAAAACTACTGTTTTGATTCCATTCCAAAGCTTATTCATTATCATCAACACAATTCAGCAGGCATGATCACACGGCTCCGCCACCCTGTGTCAACAAAGGCCAACAAGGTCCCCGACTCTGTGTCCCTGGGAAATGGAATCTGGGAACTGAAAAGAGAAGAGATTACCTTGTTGAAGGAGCTGGGAAGTGGCCAGTTTGGAGTGGTCCAGCTGGGCAAGTGGAAGGGGCAGTATGATGTTGCTGTTAAGATGATCAAGGAGGGCTCCATGTCAGAAGATGAATTCTTTCAGGAGGCCCAGACTATGATGAAACTCAGCCATCCCAAGCTGGTTAAATTCTATGGAGTGTGTTCAAAGGAATACCCCATATACATAGTGACTGAATATATAAGCAATGGCTGCTTGCTGAATTACCTGAGGAGTCACGGAAAAGGACTTGAACCTTCCCAGCTCTTAGAAATGTGCTACGATGTCTGTGAAGGCATGGCCTTCTTGGAGAGTCACCAATTCATACACCGGGACTTGGCTGCTCGTAACTGCTTGGTGGACAGAGATCTCTGTGTGAAAGTATCTGACTTTGGAATGACAAGGTATGTTCTTGATGACCAGTATGTCAGTTCAGTCGGAACAAAGTTTCCAGTCAAGTGGTCAGCTCCAGAGGTGTTTCATTACTTCAAATACAGCAGCAAGTCAGACGTATGGGCATTTGGGATCCTGATGTGGGAGGTGTTCAGCCTGGGGAAGCAGCCCTATGACTTGTATGACAACTCCCAGGTGGTTCTGAAGGTCTCCCAGGGCCACAGGCTTTACCGGCCCCACCTGGCATCGGACACCATCTACCAGATCATGTACAGCTGCTGGCACGAGCTTCCAGAAAAGCGTCCCACATTTCAGCAACTCCTGTCTTCCATTGAACCACTTCGGGAAAAAGACAAGCATTGA

Length: 2028

View AllClose

0 Reviews

View AllClose