Human BCKDHB cDNA Clone BC040139 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL002606HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BCKDHB
Gene ID:
594
Accession #:
BC040139
Plasmid:
pUC
€406.00
Frequently bought together:

Description

Human BCKDHB cDNA Clone BC040139 pUC Plasmid | Cusabio

Gene Name: BCKDHB

Gene ID: 594

Accession Number: BC040139

Vector: pUC

Sequence: ATGGCGGTTGTAGCGGCGGCTGCCGGCTGGCTACTCAGGCTCAGGGCGGCAGGGGCTGAGGGGCACTGGCGTCGGCTTCCTGGCGCGGGGCTGGCGCGGGGCTTTTTGCACCCCGCCGCGACTGTCGAGGATGCGGCCCAGAGGCGGCAGGTGGCTCATTTTACTTTCCAGCCAGATCCGGAGCCCCGGGAGTACGGGCAAACTCAGAAAATGAATCTTTTCCAGTCTGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGTGAAGATGTTGCCTTTGGTGGAGTCTTTAGATGCACTGTTGGCTTGCGAGACAAATATGGAAAAGATAGAGTTTTTAATACCCCATTGTGTGAACAAGGAATTGTTGGATTTGGAATCGGAATTGCGGTCACTGGAGCTACTGCCATTGCGGAAATTCAGTTTGCAGATTATATTTTCCCTGCATTTGATCAGATTGTTAATGAAGCTGCCAAGTATCGCTATCGCTCTGGGGATCTTTTTAACTGTGGAAGCCTCACTATCCGGTCCCCTTGGGGCTGTGTTGGTCATGGGGCTCTCTATCATTCTCAGAGTCCGGAAGCATTTTTTGCCCATTGCCCAGGAATCAAGGTGGTTATACCCAGAAGCCCTTTCCAGGCCAAAGGACTTCTTTTGTCATGCATAGAGGATAAAAATCCTTGTATATTTTTTGAACCTAAAATACTTTACAGGGCAGCAGCGGAAGAAGTCCCTATAGAACCATACAACATCCCACTGTCCCAGGCCGAAGTCATACAGGAAGGGAGTGATGTTACTCTAGTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTAGCTTCCATGGCAAAAGAAAAGCTTGGAGTGTCTTGTGAAGTCATTGATCTGAGGACTATAATACCTTGGGATGTGGACACAATTTGTAAGTCTGTGATCAAAACAGGGCGACTGCTAATCAGTCACGAGGCTCCCTTGACAGGCGGCTTTGCATCGGAAATCAGCTCTACAGTTCAGGAGGAATGTTTCTTGAACCTAGAGGCTCCTATATCAAGAGTATGTGGTTATGACACACCATTTCCTCACATTTTTGAACCATTCTACATCCCAGACAAATGGAAGTGTTATGATGCCCTTCGAAAAATGATCAACTATTGA

Length: 1179

View AllClose

0 Reviews

View AllClose