Human BATF cDNA Clone BC032294 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL619074HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BATF
Gene ID:
10538
Accession #:
BC032294
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human BATF cDNA Clone BC032294 pENTR223.1 Plasmid | Cusabio

Gene Name: BATF

Gene ID: 10538

Accession Number: BC032294

Vector: pENTR223.1

Sequence: ATGCCTCACAGCTCCGACAGCAGTGACTCCAGCTTCAGCCGCTCTCCTCCCCCTGGCAAACAGGACTCATCTGATGATGTGAGAAGAGTTCAGAGGAGGGAGAAAAATCGTATTGCCGCCCAGAAGAGCCGACAGAGGCAGACACAGAAGGCCGACACCCTGCACCTGGAGAGCGAAGACCTGGAGAAACAGAACGCGGCTCTACGCAAGGAGATCAAGCAGCTCACAGAGGAACTGAAGTACTTCACGTCGGTGCTGAACAGCCACGAGCCCCTGTGCTCGGTGCTGGCCGCCAGCACGCCCTCGCCCCCCGAGGTGGTGTACAGCGCCCACGCATTCCACCAACCTCATGTCAGCTCCCCGCGCTTCCAGCCCTGA

Length: 378

View AllClose

0 Reviews

View AllClose