null

Human BAIAP2L1 cDNA Clone BC013888 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL887045HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BAIAP2L1
Gene ID:
55971
Accession #:
BC013888
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human BAIAP2L1 cDNA Clone BC013888 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: BAIAP2L1

Gene ID: 55971

Accession Number: BC013888

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCCCGGGGGCCCGAGGAGGTGAACCGGCTCACGGAGAGCACCTACCGGAATGTTATGGAACAGTTCAATCCTGGGCTGCGAAATTTAATAAACCTGGGGAAAAATTATGAGAAAGCTGTAAACGCTATGATCCTGGCAGGAAAAGCCTACTACGATGGAGTGGCCAAGATCGGTGAGATTGCCACTGGGTCCCCCGTGTCAACTGAACTGGGACATGTCCTCATAGAGATTTCAAGTACCCACAAGAAACTCAACGAGAGTCTTGATGAAAATTTTAAAAAATTCCACAAAGAGATTATCCATGAGCTGGAGAAGAAGATAGAACTTGACGTGAAATATATGAACGCAACTCTAAAAAGATACCAAACAGAACACAAGAATAAATTAGAGTCTTTGGAGAAATCCCAAGCTGAGTTGAAGAAGATCAGAAGGAAAAGCCAAGGAAGCCGAAACGCACTCAAATATGAACACAAAGAAATTGAGTATGTGGAGACCGTTACTTCTCGTCAGAGTGAAATCCAGAAATTCATTGCAGATGGTTGCAAAGAGGCTCTGCTTGAAGAGAAGAGGCGCTTCTGCTTTCTGGTTGATAAGCACTGTGGCTTTGCAAACCACATACATTATTATCACTTACAGTCTGCAGAACTACTGAATTCCAAGCTGCCTCGGTGGCAGGAGACCTGTGTTGATGCCATCAAAGTGCCAGAGAAAATCATGAATATGATCGAAGAAATAAAGACCCCAGCCTCTACCCCCGTGTCTGGAACTCCTCAGGCTTCACCCATGATCGAGAGAAGCAATGTGGTTAGGAAAGATTACGACACCCTTTCTAAATGCTCACCAAAGATGCCCCCCGCTCCTTCAGGCAGAGCATATACCAGTCCCTTGATCGATATGTTTAATAACCCAGCCACGGCTGCCCCGAATTCACAAAGGGTAAATAATTCAACAGGTACTTCCGAAGATCCCAGTTTACAGCGATCAGTTTCGGTTGCAACGGGACTGAACATGATGAAGAAGCAGAAAGTGAAGACCATCTTCCCGCACACTGCGGGCTCCAACAAGACCTTACTCAGCTTTGCACAGGGAGATGTCATCACGCTGCTCATCCCCGAGGAGAAGGATGGCTGGCTCTATGGAGAACACGACGTGTCCAAGGCGAGGGGTTGGTTCCCGTCGTCGTACACGAAGTTGCTGGAAGAAAATGAGACAGAAGCAGTGACCGTGCCCACGCCAAGCCCCACACCAGTGAGAAGCATCAGCACCGTGAACTTGTCTGAGAATAGCAGTGTTGTCATCCCCCCACCCGACTACTTGGAATGCTTGTCCATGGGGGCAGCTGCCGACAGGAGAGCAGATTCGGCCAGGACGACATCCACCTTTAAGGCCCCAGCGTCCAAGCCCGAGACCGCGGCTCCTAACGATGCCAACGGGACTGCAAAGCCGCCTTTTCTCAGCGGAGAAAACCCCTTTGCCACTGTGAAACTCCGCCCGACTGTGACGAATGATCGCTCGGCACCCATCATTCGATGA

Length: 1536

View AllClose

0 Reviews

View AllClose