Human B4GALT6 cDNA Clone BC069620 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL871391HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
B4GALT6
Gene ID:
9331
Accession #:
BC069620
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human B4GALT6 cDNA Clone BC069620 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: B4GALT6

Gene ID: 9331

Accession Number: BC069620

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTGTGCTCAGGCGGATGATGCGGGTTTCCAATCGCTCTCTCCTCGCCTTCATCTTCTTCTTCTCCCTCTCTTCGTCCTGTCTGTACTTCATCTATGTGGCCCCAGGCATCGCCAACACATATCTCTTTATGGTACAAGCTCGAGGTATAATGTTGAGAGAAAATGTGAAAACAATAGGTCATATGATCAGGCTGTACACAAATAAAAACAGTACGCTCAACGGTACAGATTATCCCGAAGGCAATAATTCAAGTGATTATCTTGTTCAAACAACAACGTATCTCCCGGAAAACTTCACATACTCACCATACCTCCCCTGTCCAGAAAAGCTGCCTTATATGCGAGGATTCCTCAATGTCAATGTAAGCGAAGTCAGTTTTGATGAAATTCATCAACTCTTCTCCAAGGATTTAGATATTGAGCCAGGGGGTCATTGGAGGCCAAAAGACTGTAAACCCAGATGGAAGACTGGCACACAACCTTTTAACCGTGCGATGCTTTTCAATGTGGGCTTCAAAGAGGCCATGAAAGACAGTGTCTGGGACTGTGTAATCTTCCACGATGTGGATCATCTACCTGAAAATGACCGGAACTATTACGGATGTGGAGAAATGCCACGTCATTTTGCTGCAAAGCTGGATAAATACATGTATATTCTTCCATATAAAGAATTTTTTGGTGGTGTAAGTGGGCTGACAGTGGAACAATTTAGAAAGATCAATGGTTTTCCTAATGCCTTCTGGGGATGGGGAGGAGAAGATGATGACCTTTGGAACAGAGTTCACTATGCTGGATATAATGTAACCAGACCAGAGGGAGACTTAGGAAAATACAAGTCAATTCCTCATCACCATAGAGGTGAAGTCCAGTTTTTAGGACGGTATAAATTACTAAGGTATTCCAAGGAGCGTCAGTACATCGATGGACTGAACAATTTAATATATAGGCCAAAAATACTGGTTGATAGGTTGTATACAAACATATCTGTAAACCTCATGCCAGAGTTAGCTCCAATCGAAGACTATTAA

Length: 1032

View AllClose

0 Reviews

View AllClose