null

Human B3GAT3 cDNA Clone BC007906 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL002498HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
B3GAT3
Gene ID:
26229
Accession #:
BC007906
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human B3GAT3 cDNA Clone BC007906 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: B3GAT3

Gene ID: 26229

Accession Number: BC007906

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAGCTGAAGCTGAAGAACGTGTTTCTCGCCTACTTCCTGGTGTCGATCGCCGGCCTCCTCTACGCGCTGGTACAGCTCGGCCAGCCATGTGACTGCCTTCCTCCCCTGCGGGCAGCAGCCGAGCAGCTACGGCAGAAGGATCTGAGGATTTCCCAGCTGCAAGCGGAACTCCGACGGCCACCCCCTGCCCCTGCCCAGCCCCCTGAACCCGAGGCCCTGCCTACTATCTATGTTGTTACCCCCACCTATGCCAGGCTGGTACAGAAGGCAGAGCTGGTACGACTGTCCCAGACACTGAGCCTGGTGCCCCGGCTGCATTGGCTGCTGGTGGAGGATGCTGAGGGTCCCACCCCGCTGGTCTCAGGGCTGCTGGCTGCCTCTGGCCTCCTCTTCACACACCTGGTGGTCCTCACGCCCAAAGCCCAGCGGCTTCGGGAGGGCGAGCCTGGCTGGGTTCATCCCCGTGGTGTCGAGCAGCGGAACAAGGCCCTGGACTGGCTCCGGGGCAGAGGGGGTGCTGTGGGTGGGGAGAAGGACCCACCACCACCAGGGACCCAAGGAGTCGTCTACTTTGCTGACGATGACAACACCTACAGCCGGGAGCTGTTTGAGGAGATGCGCTGGACCCGTGGTGTCTCAGTGTGGCCTGTGGGGCTGGTGGGCGGCCTGCGATTCGAGGGCCCTCAGGTACAGGACGGCCGGGTAGTGGGCTTCCACACAGCATGGGAGCCCAGCAGGCCCTTCCCTGTGGATATGGCTGGATTTGCCGTGGCCCTGCCCTTGCTGTTAGATAAGCCCAATGCCCAATTTGATTCCACCGCTCCCCGGGGCCACCTGGAGAGCAGTCTTCTGAGCCACCTTGTGGATCCCAAGGACCTGGAGCCACGGGCTGCCAACTGCACTCGGGTACTGGTGTGGCATACTCGGACAGAGAAGCCCAAGATGAAGCAGGAGGAGCAGCTGCAGCGGCAGGGCCGGGGCTCAGACCCAGCAATTGAGGTGTGA

Length: 1008

View AllClose

0 Reviews

View AllClose