Human ADD2 cDNA Clone BC041666 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001349HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADD2
Gene ID:
119
Accession #:
BC041666
Plasmid:
pUC
€601.00
Frequently bought together:

Description

Human ADD2 cDNA Clone BC041666 pUC Plasmid | Cusabio

Gene Name: ADD2

Gene ID: 119

Accession Number: BC041666

Vector: pUC

Sequence: ATGAGCGAAGAGACGGTCCCCGAGGCTGCCTCGCCGCCGCCCCCGCAGGGGCAGCCTTACTTTGACCGCTTCTCAGAGGACGACCCCGAGTACATGCGCCTTCGCAACCGGGCGGCGGACCTGCGGCAGGACTTCAACCTGATGGAGCAGAAGAAGCGCGTCACCATGATCCTGCAGAGTCCCTCTTTCAGGGAGGAGCTGGAAGGCCTCATCCAGGAGCAGATGAAGAAGGGGAACAACTCCTCCAACATCTGGGCCCTGCGACAGATCGCGGACTTCATGGCCAGCACCTCCCACGCAGTCTTCCCGACATCTTCCATGAATGTCTCCATGATGACGCCTATCAATGACCTCCACACAGCTGACTCCCTGAACCTGGCCAAAGGGGAGCGGCTCATGCGGTGCAAGATCAGCAGTGTCTACCGACTCCTGGACCTCTATGGCTGGGCCCAGCTGAGTGACACCTATGTCACGTTGAGAGTCAGCAAGGAGCAGGACCACTTCCTGATCAGCCCTAAGGGAGTTTCTTGCAGTGAAGTCACAGCGTCCAGCCTGATCAAGGTGAACATTCTGGGAGAGGTGGTGGAGAAGGGCAGCAGCTGCTTCCCAGTGGACACCACAGGCTTCTGTCTGCACTCGGCCATCTATGCAGCGAGGCCCGACGTGCGCTGCATCATCCACCTGCACACACCGGCCACAGCAGCGGTGTCGGCCATGAAGTGGGGCCTCCTGCCTGTCTCCCACAATGCCCTGCTGGTGGGGGACATGGCCTATTATGACTTCAATGGGGAAATGGAGCAGGAAGCCGATCGGATCAACCTGCAGAAGTGCCTTGGACCCACCTGCAAGATCCTGGTGCTAAGAAACCATGGAGTGGTTGCTCTGGGTGACACGGTAGAGGAGGCATTTTACAAGATCTTCCACCTGCAGGCTGCATGTGAGATACAGGTGTCGGCTCTGTCCAGTGCCGGGGGAGTGGAGAACCTCATCCTCCTGGAGCAGGAGAAGCACCGGCCCCATGAGGTGGGCTCCGTGCAGTGGGCCGGGAGCACCTTTGGGCCTATGCAGAAGAGTCGGCTGGGGGAGCATGAGTTTGAGGCCCTCATGAGGATGCTGGACAACCTGGGCTACAGAACAGGTTACACGTATCGCCACCCCTTTGTTCAAGAGAAAACCAAACACAAAAGTGAGGTGGAGATTCCAGCCACGGTCACAGCCTTCGTGTTTGAGGAGGACGGTGCCCCGGTGCCCGCCCTGCGACAGCATGCCCAGAAGCAGCAGAAGGAGAAGACCCGCTGGCTCAATACGCCCAACACCTACCTGCGGGTCAATGTGGCCGATGAGGTCCAGAGGAGCATGGGCAGCCCCCGACCCAAGACCACGTGGATGAAGGCTGACGAGGTGGAGAAATCCAGCAGTGGCATGCCGATTCGCATCGAAAACCCAAACCAATTTGTGCCTCTCTATACTGACCCCCAGGAAGTACTGGAGATGAGGAACAAGATTCGAGAACAAAACCGACAAGATGTGAAGTCAGCGGGGCCTCAGTCCCAGCTCCTGGCGAGCGTCATTGCCGAGAAGAGCCGAAGCCCGTCTACAGAGAGCCAGCTGATGTCCAAGGGAGACGAGGATACCAAAGACGATTCAGAGGAGACGGTGCCCAACCCCTTCAGCCAACTCACTGACCAGGAGTTGGAGGAGTACAAGAAAGAGGTGGAGAGGAAGAAACTAGAACTTGATGAGACAGGACAGGAACGAGAGCCAGGCTCTGGTCCGGCCGTGTGCGAGTTCTTCAGCGTTGCCCTCCACATCTGGAGTAACATATTGGAGAGAAAGAAACTGCCCCAGAAGAGCCTGGCTCACCTGCAAAGTCTGCACCTGCTTCTCCAGTGCAGAGCCCAGCGAAGGAGGCAGAGACAAAGAGCCCTTTAG

Length: 1932

View AllClose

0 Reviews

View AllClose