Human ADCY4 cDNA Clone BC117473 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822782HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADCY4
Gene ID:
196883
Accession #:
BC117473
Plasmid:
pUC
€1,069.00
Frequently bought together:

Description

Human ADCY4 cDNA Clone BC117473 pUC Plasmid | Cusabio

Gene Name: ADCY4

Gene ID: 196883

Accession Number: BC117473

Vector: pUC

Sequence: ATGGCCCGCCTCTTCAGCCCCCGGCCGCCCCCCAGCGAAGACCTCTTCTACGAGACCTACTACAGCCTGAGCCAGCAGTACCCGCTGCTGCTGCTGCTGCTGGGGATCGTGCTCTGTGCGCTCGCGGCGCTGCTCGCAGTGGCCTGGGCCAGCGGCAGGGAGCTGACCTCAGACCCGAGCTTCCTGACCACTGTGCTGTGCGCGCTGGGCGGCTTCTCGCTGCTGCTGGGCCTCGCTTCCCGGGAGCAGCGACTGCAGCGCTGGACGCGTCCCCTGTCCGGCTTGGTATGGGTCGCGCTGCTAGCGCTAGGCCACGCCTTCCTGTTCACCGGGGGCGTGGTGAGCGCCTGGGACCAGGTGTCCTATTTTCTCTTCGTCATCTTCACGGCGTATGCCATGCTGCCCTTGGGCATGCGGGACGCCGCCGTCGCGGGCCTCGCCTCCTCACTCTCGCATCTGCTGGTCCTCGGGCTGTATCTTGGGCCACAGCCGGACTCACGGCCTGCACTGCTGCCGCAGTTGGCAGCAAACGCAGTGCTGTTCCTGTGCGGGAACGTGGCAGGAGTGTACCACAAGGCGCTGATGGAGCGCGCCCTGCGGGCCACGTTCCGGGAGGCACTCAGCTCCCTGCACTCACGCCGGCGGCTGGACACCGAGAAGAAGCACCAGGAACACCTTCTCTTGTCCATCCTTCCTGCCTACCTGGCCCGAGAGATGAAGGCAGAGATCATGGCACGGCTGCAGGCAGGACAGGGGTCACGGCCAGAGAGCACTAACAATTTCCACAGCCTCTATGTCAAGAGGCACCAGGGAGTCAGCGTGCTGTATGCTGACATCGTGGGCTTCACGCGGCTGGCCAGCGAGTGTTCCCCTAAGGAGCTGGTGCTCATGCTCAATGAGCTCTTTGGCAAGTTCGACCAGATTGCCAAGGAGCATGAATGCATGCGGATCAAGATCCTGGGGGACTGTTACTACTGTGTCTCTGGGCTGCCACTCTCACTGCCAGACCATGCCATCAACTGCGTGCGCATGGGCCTGGACATGTGCCGGGCCATCAGGAAACTGCGGGCAGCCACTGGCGTGGACATCAACATGCGTGTGGGCGTGCACTCAGGCAGCGTACTGTGTGGAGTCATCGGGCTGCAGAAGTGGCAGTACGACGTTTGGTCACATGATGTCACACTGGCTAACCACATGGAGGCAGGCGGTGTACCAGGGCGAGTGCACATCACAGGGGCTACCCTGGCCCTGCTGGCAGGGGCTTATGCTGTGGAGGACGCAGGCATGGAGCATCGGGACCCCTACCTTCGGGAGCTAGGGGAGCCTACCTATCTGGTCATCGATCCACGGGCAGAGGAGGAGGATGAGAAGGGCACTGCAGGAGGCTTGCTGTCCTCGCTTGAGGGCCTCAAGATGCGTCCATCACTGCTGATGACCCGTTACCTGGAGTCCTGGGGCGCAGCCAAGCCTTTTGCCCACCTGAGCCACGGAGACAGCCCTGTGTCCACCTCCACCCCTCTCCCGGAGAAGACCCTGGCTTCCTTCAGCACCCAGTGGAGCCTGGATCGGAGCCGTACCCCCCGGGGACTAGATGATGAACTGGACACCGGGGATGCCAAGTTCTTCCAGGTCATTGAGCAGCTCAACTCGCAGAAACAGTGGAAGCAGTCGAAGGACTTCAACCCACTGACACTGTACTTCAGAGAGAAGGAGATGGAGAAAGAGTACCGACTCTCTGCAATCCCCGCCTTCAAATACTATGAAGCCTGCACCTTCCTGGTTTTTCTCTCCAACTTCATCATCCAGATGCTAGTGACAAACAGGCCCCCAGCTCTGGCCATCACGTATAGCATCACCTTCCTCCTCTTCCTCCTCATCCTTTTTGTCTGCTTCTCAGAGGACCTGATGAGGTGTGTCCTGAAAGGCCCCAAGATGCTGCACTGGCTGCCTGCACTGTCTGGCCTGGTGGCCACACGACCAGGACTGAGAATAGCCTTGGGCACCGCCACCATCCTCCTTGTCTTTGCCATGGCCATTACCAGCCTGTTCTTCTTCCCAACATCATCAGACTGCCCTTTCCAAGCTCCCAATGTGTCCTCCATGATTTCCAACCTCTCCTGGGAGCTCCCTGGGTCTCTGCCTCTCATCAGTGTCCCATACTCCATGCACTGCTGCACGCTGGGCTTCCTCTCCTGCTCCCTCTTTCTGCACATGAGCTTCGAGCTGAAGCTGCTGCTGCTCCTGCTGTGGCTGGCGGCATCCTGCTCCCTCTTCCTGCACTCCCATGCCTGGCTGTCGGAATGCCTCATCGTCCGCCTCTATCTGGGCCCCTTGGACTCCAGGCCCGGAGTGCTGAAGGAGCCCAAACTGATGGGTGCTATCTCCTTCTTCATCTTCTTCTTCACCCTCCTTGTCCTGGCTCGCCAGAATGAGTACTACTGCCGCCTGGACTTCCTGTGGAAGAAGAAGCTGAGGCAGGAGAGGGAGGAGACAGAGACGATGGAGAACCTGACTCGGCTGCTCTTGGAGAACGTGCTCCCTGCACACGTGGCCCCCCAGTTCATTGGCCAGAACCGGCGCAACGAGGATCTCTACCACCAGTCCTATGAATGCGTTTGTGTCCTCTTCGCCTCAGTCCCAGACTTCAAGGAGTTCTACTCTGAATCCAACATCAATCATGAGGGCCTAGAGTGTCTGAGGCTGCTCAATGAGATAATTGCTGATTTTGATGAGCTGCTCTCCAAGCCCAAGTTCAGTGGGGTGGAGAAGATCAAGACCATCGGCAGCACCTACATGGCAGCCACAGGCTTAAATGCCACCTCTGGACAGGATGCACAACAGGATGCTGAACGGAGCTGCAGCCACCTTGGCACTATGGTGGAATTTGCCGTGGCCCTGGGGTCTAAGCTGGACGTCATCAACAAGCATTCATTCAACAACTTCCGCCTGCGAGTGGGGTTGAACCATGGACCCGTAGTAGCTGGAGTTATTGGGGCCCAGAAGCCGCAATATGACATTTGGGGCAACACAGTGAACGTGGCCAGCCGCATGGAGAGTACAGGAGTCCTTGGCAAAATCCAAGTGACTGAGGAGACAGCATGGGCCCTACAGTCCCTGGGCTACACCTGCTACAGCCGGGGTGTCATCAAGGTGAAAGGCAAAGGGCAGCTCTGCACCTACTTCCTGAACACAGACTTGACACGAACTGGACCTCCTTCAGCTACCCTAGGCTGA

Length: 3234

View AllClose

0 Reviews

View AllClose