Human ADCK5 cDNA Clone BC031570 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL664749HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADCK5
Gene ID:
203054
Accession #:
BC031570
Plasmid:
pUC
€232.00
Frequently bought together:

Description

Human ADCK5 cDNA Clone BC031570 pUC Plasmid | Cusabio

Gene Name: ADCK5

Gene ID: 203054

Accession Number: BC031570

Vector: pUC

Sequence: ATGAGGGCGCACGCAGCCGCACTGGGGGTGCAAGACTACCTCCTGTTCGCCGAGATGCTCATGCAGCGCCCCGTGCGCCTGGGGCAGCTGTGGGGCTCGCACCTACTGAGCCGCGAAGAGGCGGCCTACATGGTGGACATGGCCCGCGAGCGCTTCGAGGCCGTCATGGCGGTGCTCAGGGAGCTGCCGCGGCCCATGCTGCTGGTGCTGCGCAACATCAACACCGTGCGCGCTATCAACGTGGCCCTCGGCGCCCCCGTGGACCGCTACTTCCTTATGGCTAAAAGGGCTGTCCGGGGCTGGAGCCGCCTGGCGGGCGCCACGTATCGGGGTGTCTACGGCACCAGCCTCCTGCGCCACGCCAAGGTCGTCTGGGAGATGCTCAAGTTTGAAGTGGCGCTCAGGCTGGAGACCTTGGCCATGCGGCTGACCGCCCTCCTGGCTCGTGCTCTGGTCCACCTGAGCCTCGTGCCCCCAGCGGAGGAGCTCTACCAGTACCTGGAGACCTAG

Length: 510

View AllClose

0 Reviews

View AllClose