Human ADAM8 cDNA Clone BC115404 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001295HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADAM8
Gene ID:
101
Accession #:
BC115404
Plasmid:
pUC
€743.00
Frequently bought together:

Description

Human ADAM8 cDNA Clone BC115404 pUC Plasmid | Cusabio

Gene Name: ADAM8

Gene ID: 101

Accession Number: BC115404

Vector: pUC

Sequence: ATGCGCGGCCTCGGGCTCTGGCTGCTGGGCGCGATGATGCTGCCTGCGATTGCCCCCAGCCGGCCCTGGGCCCTCATGGAGCAGTATGAGGTCGTGTTGCCGCGGCGTCTGCCAGGCCCCCGAGTCCGCCGAGCTCTGCCCTCCCACTTGGGCCTGCACCCAGAGAGGGTGAGCTACGTCCTTGGGGCCACAGGGCACAACTTCACCCTCCACCTGCGGAAGAACAGGGACCTGCTGGGTTCCGGCTACACAGAGACCTATACGGCTGCCAATGGCTCCGAGGTGACGGAGCAGCCTCGCGGGCAGGACCACTGCTTCTACCAGGGCCACGTAGAGGGGTACCCGGACTCAGCCGCCAGCCTCAGCACCTGTGCCGGCCTCAGGGGTTTCTTCCAGGTGGGGTCAGACCTGCACCTGATCGAGCCCCTGGATGAAGGTGGCGAGGGCGGACGGCACGCCGTGTACCAGGCTGAGCACCTGCTGCAGACGGCCGGGACCTGCGGGGTCAGCGACGACAGCCTGGGCAGCCTCCTGGGACCCCGGACGGCAGCCGTCTTCAGGCCTCGGCCCGGGGACTCTCTGCCATCCCGAGAGACCCGCTACGTGGAGCTGTATGTGGTCGTGGACAATGCAGAGTTCCAGATGCTGGGGAGCGAAGCAGCCGTGCGTCATCGGGTGCTGGAGGTGGTGAATCACGTGGACAAGCTATATCAGAAACTCAACTTCCGTGTGGTCCTGGTGGGCCTGGAGATTTGGAATAGTCAGGACAGGTTCCACGTCAGCCCCGACCCCAGTGTCACACTGGAGAACCTCCTGACCTGGCAGGCACGGCAACGGACACGGCGGCACCTGCATGACAACGTACAGCTCATCACGGGTGTCGACTTCACCGGGACTACTGTGGGGTTTGCCAGGGTGTCCGCCATGTGCTCCCACAGCTCAGGGGCTGTGAACCAGGACCACAGCAAGAACCCCGTGGGCGTGGCCTGCACCATGGCCCATGAGATGGGCCACAACCTGGGCATGGACCATGATGAGAACGTCCAGGGCTGCCGCTGCCAGGAACGCTTCGAGGCCGGCCGCTGCATCATGGCAGGCAGCATTGGCTCCAGTTTCCCCAGGATGTTCAGTGACTGCAGCCAGGCCTACCTGGAGAGCTTTTTGGAGCGGCCGCAGTCGGTGTGCCTCGCCAACGCCCCTGACCTCAGCCACCTGGTGGGCGGCCCCGTGTGTGGGAACCTGTTTGTGGAGCGTGGGGAGCAGTGCGACTGCGGCCCCCCCGAGGACTGCCGGAACCGCTGCTGCAACTCTACCACCTGCCAGCTGGCTGAGGGGGCCCAGTGTGCGCACGGTACCTGCTGCCAGGAGTGCAAGGTGAAGCCGGCTGGTGAGCTGTGCCGTCCCAAGAAGGACATGTGTGACCTCGAGGAGTTCTGTGACGGCCGGCACCCTGAGTGCCCGGAAGACGCCTTCCAGGAGAACGGCACGCCCTGCTCCGGGGGCTACTGCTACAACGGGGCCTGTCCCACACTGGCCCAGCAGTGCCAGGCCTTCTGGGGGCCAGGTGGGCAGGCTGCCGAGGAGTCCTGCTTCTCCTATGACATCCTACCAGGCTGCAAGGCCAGCCGGTACAGGGCTGACATGTGTGGCGTTCTGCAGTGCAAGGGTGGGCAGCAGCCCCTGGGGCGTGCCATCTGCATCGTGGATGTGTGCCACGCGCTCACCACAGAGGATGGCACTGCGTATGAACCAGTGCCCGAGGGCACCCGGTGTGGACCAGAGAAGGTTTGCTGGAAAGGACGTTGCCAGGACTTACACGTTTACAGATCCAGCAACTGCTCTGCCCAGTGCCACAACCATGGGGTGTGCAACCACAAGCAGGAGTGCCACTGCCACGCGGGCTGGGCCCCGCCCCACTGCGCGAAGCTGCTGACTGAGGTGCACGCAGCGTCCGGGAGCCTCCCCGTCCTCGTGGTGGTGGTTCTGGTGCTCCTGGCAGTTGTGCTGGTCACCCTGGCAGGCATCATCGTCTACCGCAAAGCCCGGAGCCGCATCCTGAGCAGGAACGTGGCTCCCAAGACCACAATGGGGCGCTCCAACCCCCTGTTCCACCAGGCTGCCAGCCGCGTGCCGGCCAAGGGCGGGGCTCCAGCCCCATCCAGGGGCCCCCAAGAGCTGGTCCCCACCACCCACCCGGGCCAGCCCGCCCGACACCCGGCCTCCTCGGTGGCTCTGAAGAGGCCGCCCCCTGCTCCTCCGGTCACTGTGTCCAGCCCACCCTTCCCAGTTCCTGTCTACACCCGGCAGGCACCAAAGCAGGTCATCAAGCCAACGTTCGCACCCCCAGTGCCCCCAGTCAAACCCGGGGCTGGTGCGGCCAACCCTGGTCCAGCTGAGGGTGCTGTTGGCCCAAAGGTTGCCCTGAAGCCCCCCATCCAGAGGAAGCAAGGAGCCGGAGCTCCCACAGCACCCTAG

Length: 2475

View AllClose

0 Reviews

View AllClose