Human ADAD2 cDNA Clone BC033491 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL843326HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADAD2
Gene ID:
161931
Accession #:
BC033491
Plasmid:
pUC
€555.00
Frequently bought together:

Description

Human ADAD2 cDNA Clone BC033491 pUC Plasmid | Cusabio

Gene Name: ADAD2

Gene ID: 161931

Accession Number: BC033491

Vector: pUC

Sequence: ATGGCTTCGGCTTCTCAGGGCGCTGACGACGACGGCAGTCGTAGGAAGCCCCGCCTGGCTGCATCGTTGCAGATCAGCCCCCAGCCCCGCCCCTGGCGACCGCTACCCGCCCAGGCCCAAAGTGCCTGGGGGCCCGCGCCCGCGCCCGCGACGTATCGCGCGGAGGGCGGGTGGCCCCAGGTCTCGGTGTTGAGGGACAGTGGGCCTGGGGCAGGGGCCGGAGTCGGGGAACTGGGGGCAGCCCGGGCGTGGGAAAACTTGGGGGAACAGATGGGGAAGGCCCCGAGGGTCCCTGTGCCCCCAGCAGGGCTCAGCCTGCCGCTCAAAGACCCACCTGCCAGCCAGGCCGTGTCCTTGCTCACGGAGTACGCGGCCAGCCTGGGCATCTTCCTGCTCTTCCGGGAGGACCAGCCACCAGGTCCCTGCTTCCCCTTCTCGGTGAGCGCGGAACTGGATGGGGTGGTCTGCCCTGCGGGCACTGCGAATAGCAAGACGGAGGCCAAACAGCAGGCAGCGCTCTCTGCCCTCTGCTACATCCGGAGTCAGCTGGAGAACCCAGAGTCCCCCCAGACCTCCAGCCGGCCTCCACTGGCCCCCCTGAGCGTAGAGAACATCCTGACCCATGAGCAGCGCTGCGCAGCGTTGGTGAGCGCCGGCTTTGACCTCCTGTTGGACGAGCGCTCGCCATACTGGGCCTGTAAGGGGACTGTGGCTGGAGTCATCCTGGAGAGGGAGATCCCGCGTGCCAGGGGCCACGTGAAGGAGATCTACAAGCTGGTGGCTCTGGGCACCGGCAGCAGCTGCTGTGCTGGCTGGCTGGAGTTCTCGGGCCAGCAGCTCCACGACTGCCATGGCCTGGTCATCGCCCGCAGGGCCCTGCTGAGGTTCTTGTTCCGGCAGCTCCTGCTGGCCACACAGGGGGGCCCCAAGGGCAAGGAGCAGTCCGTGCTGGCCCCCCAGCCAGGGCCCGGACCCCCATTCACCCTCAAGCCCCGCGTCTTCCTGCACCTCTACATCAGCAACACCCCCAAGGGCGCGGCCCGTGACATCTACCTGCCCCCCACCTCGGAAGGTGGCCTCCCGCACAGCCCACCCATGCGCCTGCAGGCCCATGTGCTCGGGCAGCTGAAGCCTGTGTGCTACGTGGCGCCCTCGCTCTGTGACACCCACGTGGGCTGCCTGTCAGCCAGCGACAAGCTGGCACGCTGGGCCGTGCTGGGGCTGGGTGGTGCCCTGCTGGCCCACCTGGTGTCCCCACTCTACAGCACCAGCCTCATCCTGGCTGACTCATGCCACGACCCTCCGACTCTGAGCAGGGCCATCCACACCCGGCCCTGCCTGGACAGTGTCCTGGGGCCATGCCTGCCACCTCCCTACGTCCGGACCGCCCTGCACCTGTTTGCAGGGCCCCCGGTGGCCCCTTCCGAACCCACCCCTGACACCTGCCGTGGCCTGAGCCTCAACTGGAGCCTGGGGGACCCTGGCATCGAGGTTGTGGATGTGGCCACCGGGCGTGTGAAGGCCAATGCCGCCCTGGGGCCTCCCTCCCGTCTCTGCAAGGCCTCCTTTCTCCGGGCCTTTCACCAGGCGGCCAGGGCTGTGGGGAAGCCCTACCTCCTGGCCTTGAAGACCTACGAGGCTGCCAAGGCTGGGCCCTACCAGGAGGCTCGCAGGCAGCTGTCTCTCCTCCTGGACCAGCAGGGCCTGGGGGCTTGGCCCTCGAAGCCACTGGTGGGCAAATTCAGAAACTGA

Length: 1752

View AllClose

0 Reviews

View AllClose