Human ACYP1 cDNA Clone BC035568 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001265HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACYP1
Gene ID:
97
Accession #:
BC035568
Plasmid:
pUC
€178.00
Frequently bought together:

Description

Human ACYP1 cDNA Clone BC035568 pUC Plasmid | Cusabio

Gene Name: ACYP1

Gene ID: 97

Accession Number: BC035568

Vector: pUC

Sequence: ATGGCAGAAGGAAACACCCTGATATCAGTGGATTATGAAATTTTTGGGAAGGTGCAAGGGGTGTTTTTCCGTAAGCATACTCAGGCTGAGGGTAAAAAGCTGGGATTGGTAGGCTGGGTCCAGAACACTGACCGGGGCACAGTGCAAGGACAATTGCAAGGTCCCATCTCCAAGGTGCGTCATATGCAGGAATGGCTTGAAACAAGAGGAAGTCCTAAATCACACATCGACAAAGCAAACTTCAACAATGAAAAAGTCATCTTGAAGTTGGATTACTCAGACTTCCAAATTGTAAAATAA

Length: 300

View AllClose

0 Reviews

View AllClose